Abstract
Objective
To study the correlation between hyaluronic acid (HA), hyaluronic acid synthase (HAS) and human renal clear cell carcinoma (RCCC).
Methods
The expression of three HAS isoforms’ gene and HA in 93 RCCC tissues, 27 nephridial tissues by the side of RCCC from two hospitals were measured with Real-Time RT-PCR、Western Blot and immunohistochemical methods and analyzed.
Results
All RCCC and adjacent normal tissues expressed three HASs’ mRNA & protein; at the mRNA level, both RCCC and adjacent normal tissues, expressed more HAS3 than HAS1 or HAS2, their differences were statistically significant (all P values <0.05); but, at the protein level, all HAS isoforms presented the equivalent expression. Compared with the adjacent non-neoplastic kidney tissues, the expression of all HAS isoforms’ mRNA in RCCC tissues were increased evidently and their differences were significant (all P values <0.0001); but at the protein level, only the expression of HAS3 increased evidently (P=0.022). In all adjacent normal tissues, more than 80% renal tubular cells strongly expressed HA, however, only the minority RCCC cases (16/93) presented weakly positive HA staining in few cancer nests (5%-30%), the difference were significant (P<0.0001). In RCCC tissues subgrouped according to clinical stage, pathological grade, lymphatic metastasis or not and distant metastasis or not, the HASs’ mRNA & protein differential expression all had no statistical significance (all P values >0.05).
Conclusion
Different from other malignancy, HA and HASs (except for HAS3) may not play important roles in the biological progress of human RCCC.
Key words: Renal clear cell carcinoma, Hyaluronic acid, Hyaluronic acid synthase, Gene
INTRODUCTION
Hyaluronic acid (HA), a kind of high molecular weight glycosaminoglycan with negative charge, is the impotent composition of extracellular matrix. Recent years, many studies have confirmed that HA has important effect on the progress of malignant transformation, multiplication, transfer, invasion and metastasis in malignancy[1]. But the report of relationship between HA and renal clear cell carcinoma (RCCC) is infrequent. Hyaluronic acid synthase (HAS)is the key enzyme for the synthesis of HA. Human HAS family has three subtypes: HAS1, HAS2, HAS3, enzymatic synthesis HA with different molecular weight & function[2]. To study the correlation between HA, HAS and the biological behavior of RCCC, we tested the expression of all HAS subtypes’ mRNA, protein and HA in 93 cases of human RCCC tissues and 27 cases of nephridial tissue by the side of RCCC (abbreviate as nephridial tissue) with technique of Real-Time RT-PCR, Western Blot and immunohistochemical method, and analyzed the results according to the corresponding clinical data.
MATERIALS AND METHODS
Clinical Data
The 93 renal carcinoma patients were hospitalized for operations from September 2008 to March 2010, 65 male and 28 female, 30 to 81 years old, with an average of 56.6. Thirty-eight tumors located in left kidney and 55 right. The size of tumors was 2.0 cm×1.5 cm×1.0 cm to 18 cm×12 cm×9.5 cm, average 6.5 cm×5.6 cm×4.8 cm. Thirty-five cases had clinical symptoms such as lumbago, gross (macroscopic) hematuria, etc. Clinical stages (according to 2010 revised edition of AJCC guideline of Diagnosis and treatment of RCC): 41 T1, 28 T2, 16 T3a, 7 T3b, 1 T3c, no T4; 22 N1; 29 M1 with metastasis in lung, bone, pleura, brain, parenchyma, etc. Seventy-three patients given radical nephrectomy, 20 had partial nephrectomy, 71 open and 22 Laparoscopic surgery. Cases with lymphatic metastasis had lymph node dissection and those with lymphatic or distant metastasis had biological treatment or targeted therapy after operation. Pathologic diagnosis was made after operation, tumor cell differentiation were 50 well, 36 moderate and 7 poor. The 27 nephridial tissue were obtained from the cases whose tumour were single, size <4.0 cm, without lymphatic and distant metastasis.
Specimen Collection and Preservation
Informed consents were obtained before surgery. Fresh tumor specimens were taken immediately after nephrectomy, tumor bulks resected from the solid area of the tumors, the nephridial tissue obtained far from the tumor mass (distance >2.0 cm). Every specimen was cut into two portion, one was fixed in neutral formaldehyde solution, the other was collected in cryotubes, snap frozen in liquid nitrogen for 24-48 h, then stored at -70°C. The study was approved by the Ethical Committee for Clinical Research of Peking University Shougang Hospital.
RNA Extraction
Small tissue bulks were weighted, homogenized with trizol reagent (Invitrogen, USA; 1 ml/50-100 mg tissue). Total RNA was extracted according to the manufacturer’s instructions. RNA pellets were resuspended in 20 µl DEPC water, their concentration and purity were measured by a UV-spectrophotometer.
Primers
Using Array Designer 2.03 software, PCR primers were designed (Table 1) according to the sequence of HAS1 (NM_001523), HAS2 (NM_005328), the consensus sequence of HAS3v1 (spliceosome1 NM_005329) and HAS3v2 (spliceosome2, NM_138612), and GAPDH (NM_002046).
Table 1. The information about primers used.
| Gene | Up steam primers | Down steam primers | Product length |
|---|---|---|---|
| HAS1 | 5’-TGTGACTCGGACACAAGGTTG-3’; | 5’- GCCT CAAGAAACTGCTGCAA -3’ | 262 bp |
| HAS2 | 5’- ATCCCATGGTTGGAGGTGTT -3’; | 5’- TGCCTGTCATCACCAAAGCT -3’; | 252 bp |
| HAS3 | 5’- AGCCTTTTTGCCTTCCTGGA -3’; | 5’- AAGTTGCTGCGCCACACAA -3’; | 286 bp |
| GAPDH | 5’-ACC ACA GTC CAT GCC ATC AC-3’; | 5’-TCC ACC ACC CTG TTG CTG TA-3’ | 140 bp |
Reverse Transcription
Reverse transcriptions were performed according to previous report[3], A reverse transcriptase assay kits was used (Promega, USA). The cDNA collected stored at -70°C.
Real-Time PCR
Preparation of plasmid standard: PCR reaction system was shown in Table 2 (without SYBR Green I), and amplification conditions were: 95°C for 2 min, then 95°C for 10 sec, 57°C (HAS1)/59°C (HAS2)/58°C (HAS3)/61°C (GAPDH) for 10 sec, 72°C for 45 sec, 35 cycles in total. Methods for plasmid standard preparation were demonstrated by Tingmin Yu[4]. Plasmid standards were serial 10-fold diluted, stored at -20°C.
Table 2. The reaction system of Real time PCR.
| Reagent | Working concentration | Final concentration | Volume used |
|---|---|---|---|
| H2oO | 15.1 μl | ||
| U-primer | 10 μmol/L | 0.12 μmol/L | 0.3 μl |
| D-primer | 10 μmol/L | 0.12 μmol/L | 0.3 μl |
| SYBR GreenI | 20 × | 0.4 × | 0.5 μl |
| dNTP | 2.5 mmol/L | 200 μmol/L | 2.0 μl |
| Mg++ | 2.5 mmol/L | 2 mmol/L | 2.0 μl |
| 10 × buffer | 1 × buffer | 2.5 μl | |
| Taq enzyme | 5 u/μl | 1.5 u/reac | 0.3 μl |
| cDNA | 2 μl | 2.0 μl |
Note: bulk volume=25 μl; U-primer=Upsteam prime; D-primer=Downsteam prime; reac=reaction.
Real-time PCR reaction system is compiled in Table 2 (The Taq DNA polymerase is TaqBeadTM, Promega, USA), an Applied Biosystems 7000 Real Time PCR System (Applied Biosystems, USA) was used. Real time PCR protocol for each gene: 95°C for 2.0 min, followed by 40 cycles of 95°C for 10 s, 57°C (HAS1)/59°C (HAS2)/58°C (HAS3)/61°C (GAPDH) for 10s, 72°C for 45 s. The plasmid standards of each gene and GAPDH were used as template to generate a standard curve. Melting curve was generated to confirm the specificity of the reaction products afterwards. Relative copy number of each target gene and the house- keeping gene is quantitated by a fluorescent quantitative analysis software. The entire experiment was repeated twice. Mean values were used for statistical analysis.
Western Blotting
Total protein extraction and SDS-PAG gel were prepared with conventional method. For detailed procedures of Western Blotting, see Nakata S[5]. Primary antibodies (Santa Cruz, USA) were HAS1, HAS2 (1:400 dilution), HAS3, β-actin (1:200 dilution). Straps pictures were scanned and saved as hypertexts. The density and area of each strap were digitalized with the help of GIS1000 software.
Immunohistochemical Staining
Fixed tissue was embedded in paraffin and sliced. A random section for each tissue was Haematoxylin and eosin (H & E) stained to confirm the diagnosis. Methods and reagents used in Immunohistochemical staining of HA, the evaluation criterion for positive staining were similar to previous report[6].
Data Processing and Statistical Methods
Obtained values of relative copy number of each aim gene’s mRNA were normalized by that of GAPDH mRNA. These normalized values were used to compare the expression level of each gene’s mRNA. The relative quantity of every aimed gene’s protein expression were also standardized by the house- keeping gene’s (β-actin), and one positive control was used to eliminate the error among different experiments.
SPSS 11.5 analysis software (SPSS Inc) was used, the differential expression of HASs mRNA were analyzed with rank-sum test, the expression of each tissue sample’s protein manifested as ‘x±s’, Independent-Sample T Test and One-Way ANOVA were used to analyze the different proteins expression. Chi-square test was selected to discover the differences in HA Immunohistochemical staining.
RESULTS
HAS1, HAS2 and HAS3 mRNA expression were discovered in all samples of RCCC tissue. HAS3 mRNA had the maximum expression, while the mRNA expression levels of HAS1 and HAS2 were similar (mean rank: HAS1:114.06; HAS2: 122.87, HAS3: 183.06). The differences among the mRNA expression of the three isoforms were statistically significant (χ2=40.299, P<0.001), there was statistical significance for HAS1/HAS3, HAS2/HAS3 (Z=-5.308, -5.602, P values all <0.001), while the differences between HAS2 and HAS3 were not significant (Z=-1.263, P=0.207). HAS1, HAS2 and HAS3 mRNA expression were also discovered in adjacent non-neoplastic kidney tissues, with HAS3 of the maximum expression and HAS2 of the minimum expression (mean rank: HAS1: 42.67, HAS2: 25.67, HAS3: 54.67), the differences among the mRNA expression of the three were statistically significant (χ2=20.741, P<0.001). There was statistical significance for HAS1/HAS3, HAS2/HAS3 and HAS1/HAS2 (Z=-3.196, -2.417, -3.976; P=0.001, 0.016, <0.001, respectively). Protein expression of HAS1-3 were also discovered in all tumor samples, with gray values shown as follows: HAS1: 1.1266±0.6474; HAS2: 1.6103±0.9019; HAS3: 1.2245±0.6021. There was no statistical significance among them (F=1.845, P=0.171), the differences for HAS1/HAS2, HAS1/HAS3 and HAS2/HAS3 were of no statistical significance (P values all >0.05). While in nephridial tissues, the protein expressions were: HAS1: 1.0235±0.3562; HAS2: 1.4043±1.007; HAS3: 0.5700±0.2007, the differences among them or for HAS1/HAS2, HAS1/HAS3 and HAS2/HAS3 also had no statistical significance (P values all >0.05).
In comparison with adjacent non-neoplastic kidney tissues, the RCCC tissues had a higher mRNA expression of HAS1-3. The differences were of great statistical significance
(HAS1: mean rank 67.71/35.67, Z=-4.215, P<0.0001; HAS2: mean rank 70.71/25.33, Z=-5.969, P<0.0001; HAS3: mean rank 68.97/31.33, Z=-4.950, P<0.0001). As for protein expression, there was statistical significance between the tumor tissues and the adjacent kidney tissues in HAS3 protein expression (P=0.022), On the other hand, there were non-significance in the protein expression of HAS1 or HAS2 between the tumor tissues and the adjacent kidney tissues (P=0.373, 0.701).
Renal tubular epithelial cells showed strong positive staining for HA in the sections of 27 adjacent kidney tissue samples. The percentage of positive stained cells were all more than 80%, and these cells all showed cytoplasma staining (Figure1A, B). Weak cytoplasma positive staining were detected in only 16 samples of RCCC tumor tissues, with 5%-30% percentage of positive staining tumor cells, and the tumor mesenchyme showed little positive staining (Figure 1C, D). No positive staining for HA was detected in the remaining 77 RCCC samples (Figure 1E, F). Chi-square test showed the difference of HA staining between adjacent kidney tissues and RCCC tissues were of great statistical significance (P<0.0001).
Figure 1.
The HA immuno- histochemical staining result in variant tissues. In the adjacent kidney tissue sections, renal tubular epithelial cells showed strong HA positive staining and the stain located in cytoplasma (A, B). In human renal clear cell carcinoma (RCCC) tissue, weak cytoplasma positive HA staining were detected in a few tumor cells in some cases (16/93), but the tumor mesenchyme showed little positive staining (C, D); no HA positive staining was detected in the remaining 77 RCCC samples (E, F). Magnification: A, C, E=10×10; B, D, F=10×20.
Patients with renal clear cell carcinoma were regrouped according to their clinic staging (T1/T2/T3), pathological grading (well differentiation/moderate differentiation/poor differentiation), lymphatic metastasis or not (N0/N1), distant metastasis or not (M0/M1). Detailed information of statistical comparison between different subgroups on the HAS1-3 mRNA expression was shown in Table 3 (P values all >0.05), their differences all had no statistical significance; HAS1-3 protein expression levels of different subgroups were compiled in Table 4, their differences all were not statistically significant (P values all >0.05).
Table 3. The statistical analysis result of the different HASs’ mRNA expression in variant subgroups (rank-sum test).
| Mean rank |
Z/χ value |
P value |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| HAS1 | HAS2 | HAS3 | HAS1 | HAS2 | HAS3 | HAS1 | HAS2 | HAS3 | |
| Clinic staging | |||||||||
| T1/T2/T3 | 52.57/40.33/44.75 | 50.21/41.67/47.38 | 53/37.67/47 | 3.607 | 1.656 | 5.309 | 0.165 | 0.437 | 0.070 |
| Lymphatic metastasis | |||||||||
| N0/N1 | 45.83/50.38 | 45.17/52.25 | 45.70/50.75 | -0.712 | -1.107 | -0.791 | 0.477 | 0.268 | 0.429 |
| Distant metastasis | |||||||||
| M0/M1 | 49.14/42.50 | 48.15/43.60 | 48.43/44 | -1.110 | -0.980 | -0.740 | 0.267 | 0.337 | 0.459 |
| Pathological grading (differentiation) |
|||||||||
| W/M/P | 52.13/41.25/45 | 51.18/46.50/59.50 | 53.06/47.25/59 | 5.258 | 4.753 | 3.458 | 0.072 | 0.093 | 0.177 |
Note: W=well differentiation; M=moderate differentiation; P=poor differentiation.
Table 4. The HASs’ protein expression in variant subgroups.
| HAS1 | HAS2 | HAS3 | |
|---|---|---|---|
| Clinic staging | |||
| T1 | 1.6085±1.1178 | 1.6390±0.4561 | 1.4388±0.6634 |
| T2 | 0.9843±0.3482 | 1.7118±1.2877 | 1.2827±0.5206 |
| T3 | 0.9118±0.2409 | 1.4656±0.7589 | 0.9834±0.6901 |
| Lymphatic metastasis | |||
| N0 | 1.2155±0.8364 | 1.5346±0.6568 | 1.3806±0.6977 |
| N1 | 1.0250±0.3731 | 1.6969±1.1741 | 1.0461±0.4563 |
| Distant metastasis | |||
| M0 | 1.1656±0.8458 | 1.2893±0.5962 | 1.2195±0.6327 |
| M1 | 1.1036±0.3479 | 1.9773±1.0903 | 1.2303±0.6154 |
| Pathological grading (differentiation) | |||
| Well | 0.9645±0.3200 | 1.4245±0.3217 | 1.4263±0.6501 |
| Moderate | 1.1930±0.8056 | 1.8788±1.0542 | 1.1948±0.6481 |
| Poor | 1.1520±0.4724 | 0.7740±0.0396 | 0.9550±0.3620 |
DISCUSSION
HA has broad participation in the embryogenesis of mammalian kidney[7], has important role in the process of urinary concentration in normal kidney[8]. Furthermore, HA has taken part in the process of occurrence, development and fibrosis in different kinds of nephritis and diabetic nephropathy; HA also makes a difference to the pathologic process of renal ischemia-reperfusion injury and kidney tubular crystallization[9-12]. Many studies have confirmed that HA plays very important roles in the biological process of many kinds of malignancy such as mammary cancer, gastric cancer, colorectal cancer, ovarian cancer, melanoma, glioma, lung cancer, prostatic cancer and head & neck cancer, etc[1]. But the report of relationship between HA and the biological process of renal clear cell carcinoma is infrequent.
HAS is the key enzyme of the enzymatic synthesis of HA. Human HAS family has three subtypes: HAS1, HAS2, HAS3; different HAS isoforms has different character, catalyzes HA of different molecular weight. The HA catalyzed by HAS3 is the shortest (molecular weight: 1×105−1×106 Da); the molecular weight of HA catalyzed by HAS1 is 2×105−2×106 Da; and the mean molecular weight of HA catalyzed by HAS2 is more than 2×106 Da[2]. On the other hand, HA with different length has different biological function, for example, the HA bigger than 106 Da has important function in keeping the structure and glutinousness of tissues, regulating the adhesion between cell and intercellular matrix, reducing contact inhibition, accelerating cellular immigration or transfer; the HA with the mean molecular weight less than 106 Da takes part in the process such as new vessels generation, cell multiplication and immigration, inflammatory reaction, etc[13]. Over-expression of one or more subtypes of HAS and overcompound of HA of different molecular weight in many kinds malignant cells have important function in the malignant biological behaviour process such as malignant transformation, multiplication, immune escape, invasion, adhesion, transfer, generation of tumor vessels and lymphatic, multidrug resistance, etc[1, 14-16].
Our study found that HAS3 mRNA had highest expression in human RCCC tissues and adjacent non-neoplastic kidney tissues and had significant statistical difference when compared with HAS1 and HAS2; but the expression of different subtype HAS protein had no significant statistical difference. It clewed that in RCCC tissue and adjacent non- neoplastic kidney tissue, because of being degraded or other reasons, these HAS mRNA (especially HAS3) may not thoroughly being translated into corresponding protein to catalyze different length HA, play respective role in the biological process of RCCC or physiological process of adjacent non-neoplastic kidney. However, the function of the differential expression of every HAS subtype mRNA in RCCC tissues or adjacent non-neoplastic kidney tissues are still unknown, need advanced study.
The expression of different subtype HAS mRNA in human RCCC tissues are higher than that of adjacent non-neoplastic kidney tissues and HAS3 mRNA had the maximum expression. But on protein level, only the HAS3 expression in RCCC tissues are higher than adjacent non- neoplastic kidney tissues, and had significant statistical difference. It showed that HAS3 and its catalyzed HA might have important function in the biological process of RCCC. But immunohistochemical staining showed that HA staining in human RCCC tissues are very weak while in adjacent non-neoplastic kidney tissues are strong. These results are inexplicable! The reason, we presume, the functions of every HAS isoforms (include HAS3) mRNA & protein in human RCCC tissues are not to catalyzed HA synthesis, might be others we still unknown. On the other hand, the HA catalyzed by HAS3 is very short, maybe not being tested by the linking protein used in our experiment. If true so-called, it needs more sensitive and specific means to measure different length HA to take advanced study.
When being redivided according to clinical stages, pathological grading, lymphatic metastasis or not and distant metastasis or not, the expression of all subtypes of HAS mRNA or protein had no significant statistical difference in different subgroup RCCC tissues. It showed that every HAS isoforms may have no associativity with the malignancy and clinical course of human RCCC. From other point of view, combined with the little HA expression in human RCCC tissues, it clews that, different from many other malignant tumors, HAS or HA may have no important function in the biological process of human RCCC.
REFERENCES
- 1.Toole BP, Hascall VC. Hyaluronan and tumor growth. Am J Pathol 2002; 161:745-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Itano N, Sawai T, Yoshida M, et al. Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties. J Biol Chem 1999; 274:25085-92 [DOI] [PubMed] [Google Scholar]
- 3.Cai JL, Xin DQ, Lv TJ, et al. The expression and significance of various genes of hyaluronic acid synthase isoforms in different stage/grade human bladder transitional cell carcinoma. J Clin Urol (in Chinese)2008; 23: 348-52 [Google Scholar]
- 4.Yu TM, Yao G. Development of real-time PCR assay for detection and quantitation of substance P mRNA in rats using SYBR Green. J Jilin University (Medicine Edition) (in Chinese)2008; 34:1086-8 [Google Scholar]
- 5.Nakata S, Yoshida T, Horinaka M, et al. Histone deacetylase inhibitors up-regulate death receptor 5/TRAIL-R2, and sensitize apoptosis induced by TRAIL/APO2-L in human malignant tumor cells. Oncogene 2004; 23:6261-71 [DOI] [PubMed] [Google Scholar]
- 6.Cai JL, Ye ZhQ, Yang WM, et al. The significance and expression of hyaluronic acid in human bladder transitional cell carcinoma and papilloma of bladder. Chin J Exp Surg (in Chinese)2004; 21:1226-8 [Google Scholar]
- 7.Rosines E, Schmidt HJ, Nigam SK. The effect of hyaluronic acid size and concentration on branching morphogenesis and tubule differentiation in developing kidney culture systems: potential applications to engineering of renal tissues. Biomaterials 2007; 28:4806-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bartolo RC, Donald JA. The distribution of renal hyaluronan and the expression of hyaluronan synthases during water deprivation in the Spinifex hopping mouse, Notomys alexis. Comp Biochem Physiol A Mol Integr Physiol 2007; 148:853-60 [DOI] [PubMed] [Google Scholar]
- 9.Beck-Schimmer B, Oertli B, Pasch T, et al. Hyaluronan induces monocyte chemoattractant protein-1 expression in renal tubular epithelial cells. J Am Soc Nephrol 1998; 9:2283-90 [DOI] [PubMed] [Google Scholar]
- 10.Rügheimer L, Carlsson C, Johnsson C, et al. Renal hyaluronan content during experimental uncontrolled diabetes in rats. J Physiol Pharmacol 2008; 59:115-28 [PubMed] [Google Scholar]
- 11.Declèves AE, Caron N, Nonclercq D, et al. Dynamics of hyaluronan, CD44, and inflammatory cells in the rat kidney after ischemia/reperfusion injury. Int J Mol Med 2006; 18:83-94 [PubMed] [Google Scholar]
- 12.Asselman M, Verhulst A, Van Ballegooijen ES, et al. Hyaluronan is apically secreted and expressed by proliferating or regenerating renal tubular cells. Kidney Int 2005; 68:71-83 [DOI] [PubMed] [Google Scholar]
- 13.Pummill PE, DeAngelis PL. Alteration of polysaccharide size distribution of a vertebrate hyaluronan synthase by mutation. J Biol Chem 2003; 278:19808-14 [DOI] [PubMed] [Google Scholar]
- 14.Kuang DM, Wu Y, Chen N, et al. Tumor-derived hyaluronan induces formation of immunosuppressive macrophages through transient early activation of monocytes. Blood 2007; 110:587-95 [DOI] [PubMed] [Google Scholar]
- 15.Koyama H, Kobayashi N, Harada M, et al. Significance of tumor- associated stroma in promotion of intratumoral lymphangiogenesis: pivotal role of a hyaluronan-rich tumor microenvironment. Am J Pathol 2008; 172:179-93 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ohashi R, Takahashi F, Cui R, et al. Interaction between CD44 and hyaluronate induces chemoresistance in non-small cell lung cancer cell. Cancer Lett 2007; 252:225-34 [DOI] [PubMed] [Google Scholar]