Table 1.
Strains, phages, plasmids, and primers used in this study
| Phage, strain, plasmid, or primer | Genotypes and relevant features or sequence | Source or reference |
|---|---|---|
| Phages | ||
| λ Cmr Δ(SR) | stf::cat::tfa cI857 Δ(SR); replacement of stf and tfa genes (λ nt 19996–22220) with cat gene; Δ(SR)(29); deletion of λ nt 45136–45815 (10) | Laboratory stock |
| λ-S105 | cI857 SM1L; encodes S105 only | Laboratory stock |
| λ-Y | cI857; S105 deleted, replaced by Y (nt 6691–6997 of phage P2) | This study |
| Strains | ||
| MC4100 | E. coli K-12 F− araD139 Δ(argF-lac)U169 ΔfhuA rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsR | 30 |
| XL1-Blue | E. coli K-12 recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15::Tn10 (Tetr)] | Stratagene |
| Plasmids | ||
| pS105 | λ lysis cassette under pR′ on pBR322 backbone; SM1L allele, encodes S105 only | 13 |
| pKT1-Y | Isogenic to pS105; S105 replaced by Y (nt 6691–6997 of phage P2) | This study |
| pKT2-Y | Isogenic to pKT1-Y; RT54am,K60am RzS100am RzlW38am | This study |
| pKT2-Yam | Isogenic to pKT2-Y; YS46am | This study |
| pKT2-S105 | Isogenic to pS105; RT54am,K60am RzS100am RzlW38am | This study |
| pKT1-YΔC-term | Isogenic to pKT1-Y; Arg86 to Gln93 deleted | This study |
| pKT1-YΔTMD1 | Isogenic to pKT1-Y; Ser7 to Lys22 deleted | This study |
| pKT1-Y+K | Isogenic to pKT1-Y; one Lys inserted after first Met | This study |
| pKT1-Y + 2K | Isogenic to pKT1-Y; two Lys inserted after first Met | This study |
| pLysA | Isogenic to pS105; S105RRzRz1 deleted and replaced by lysA (nt 7487 to 7934 of phage P2) | This study |
| pc-mycR::lacZ | mycR::lacZ replacement of luc in pZA32-luc | 7 |
| Primers | ||
| pKT1-Yfor | 5′GCGGTATTTCACACCGCACCTGGTGCACTCTCAG3′ | |
| pKT1-YRev | 5′CTGAGAGTGCACCAGGTGCGGTGTGAAATACCGC3′ |