Table 1. Antisense morpholino sequences.
| Morpholino | Sequence |
| Opa1 translation blocking (TB) | GATGAGTTTAGGATCTCTTTGCAGT |
| TB 5 bp mismatch control (MMC) | GATCACTTTACGATCTGTTTCCAGT |
| Opa1 splice blocking intron 12/exon 13 (SB) | ACAGTCTGCGAAAAGAAGTCAATCA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.