Table1.

Properties and amounts of primers used in real-time RT-PCR assays of marker and reference genes.

Property	CEA	hTERT	18srRNA
NCBI accession number	M29540	NM_198253	X03205
Forward primer	accctggatgtcctctatgg	tgtcacagcctgtttctgga	gtaacccgttgaaccccatt
(primer length)	(20)	(20)	(20)
(amount of use)	(10 pmol)	(15 pmol)	(10 pmol)
Reverse primer	caggcataggtcccgttatta	gttcttggctttcaggatgg	ccatccaatcggtagtagcg
(primer length)	(21)	(20)	(20)
(amount of use)	(10 pmol)	(15 pmol)	(10 pmol)
Amplicon length	209	210	152
Optimized annealing temperature	51.2˚C	48˚C	53.5˚C

CEA, carcinoembryonic antigen; hTERT, human telomerase reverse transcriptase; 18srRNA, 18s subunit of ribosomal RNA