Table 3.
Primers and PCR conditions used in ChIP assays
| DNA Binding Site (Location, PCR Product Size) | Sequence (5′ to 3′) |
|---|---|
| PCR conditions: 95°C for 2 min, 30 cycles of 95°C for 30 s (denaturation), 58°C for 30 s (annealing), and 72°C for 120 s (extension) | |
| HIF-1α/HRE (size = ∼175 bp) | |
| Forward (−989 bp) | gcttcagttcagtccatcag |
| Reverse (−816 bp) | gtcgactcgtgcactatttg |
| Internal control (∼700 bp downstream; size = 354 bp) | |
| Forward (−94 bp) | aggctgtcggctcttg |
| Reverse (+260 bp) | gtatccagccaatgttctcg |
| PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 30 s (denaturation), 55°C for 30 s (annealing), and 72°C for 90 s (extension) | |
| Creb/p-Creb(+Sp3)-CRE/AP-1 (size = ∼185 bp) | |
| Forward (−192 bp) | agcagcactgactctactctgcg |
| Reverse (−7 bp) | ttactacatcctcctcctcgtgg |
| Internal control (∼600 bp upstream; size = ∼665 bp) | |
| Forward (−1,481 bp) | caagttcgagtatagccagg |
| Reverse (−816 bp) | gtcgactcgtgcactatt |
| Creb/p-Creb(+Sp3)-HRE [internal control (∼250 bp upstream; size = ∼250 bp)] | |
| Forward (−1,481 bp) | caagttcgagtatagccagg |
| Reverse (−1,231 bp) | agaatccaagccacttggtg |
ChIP, chromatin immunoprecipitation; HIF-1α, hypoxia-inducible factor-1α; HRE, hypoxia-responsive element; Creb, cAMP response element-binding protein; p-Creb, phosphorylated Creb.