Table 5.
TAS3 genes found in the degradome during cotton SE.
| Name | Length (nt) | RPM | Sequence | Homologue | Target ID | Cleavage site | Abundance (EC/CK) | |
|---|---|---|---|---|---|---|---|---|
| EC | CK | |||||||
| ghr-TAS3a D6(+) | 21 | 2889.94 | 121.21 | TTCTTGACCTTGTAAGACCCA | Os TAS3 5’D6 | zhu2_CL19867 Contig1(ARF4) | 198 | 37/184 |
| ghr-TAS3b D7(+) | 21 | 9.39 | 8.94 | TTCTTGACCTTGTAAGACCCC | At TAS3 5’D7 | |||
| ghr-TAS3c D8(+) | 21 | 335.81 | 18.28 | TTCTTGACCTTGTAAGACCTT | At TAS3 5’D8 | zhu2_CL14460 Contig1(ARF3)# | 402 | 0/40 |
| ghr-TAS3d D7(+) | 21 | 34.02 | 2 | TTCTTGACCTTGTAAGACCCT | At TAS3 5’D7 | |||
The bases in bold are the mismatched nucleotides of cotton TAS3 genes with their homlogs in Arabidopsis.
The cleavage site is the nucleotide number from the 5’ end of cDNA.
‘#’ Validated by RLM-5’ RACE.