Table 1. Oligonucleotide Primers for Mutagenesis.

	Primer	Sequence (5′–3′)	Study
1	PlyA370G For	ctgctggatcatagtggtggctatgttgcccaa	This Study
2	PlyA370G Rev	accactatgatccagcagtaaatctccgtttct	This Study
3	PlyA370E For	ctgctggatcatagtggtgaatatgttgcccaa	This Study
4	PlyA370E Rev	accactatgatccagcagtaaatctccgtttct	This Study
5	PlyA406G For	ggcaggatttgacgggtcactttaccactag	This Study
6	PlyA406G Rev	ctagtggtaaagtgacccgtcaaatcctgcc	This Study
7	PlyA406E For	ggcaggatttgacggagcactttaccactag	This Study
8	PlyA406E Rev	ctagtggtaaagtgctccgtcaaatcctgcc	This Study
9	PlyW433G For	gagtgtaccgggcttgccggggaatggtggcgt	This Study
10	PlyW433G Rev	ggcaagcccggtacactctctaattttgac	This Study
11	PlyW433E For	gagtgtaccgggcttgccgaggaatggtggcgt	This Study
12	PlyW433E Rev	ggcaagcccggtacactctctaattttgac	This Study
13	PlyW433F For	gagtgtaccgggcttgccttcgaatggtggcgt	Thornton and McDaniel, 2005 [41]
14	PlyW433F Rev	ggcaagcccggtacactctctaattttgac	Thornton and McDaniel, 2005 [41]
15	PlyL460G For	tctatttggggaacaactggctatcctcaggta	This Study
16	PlyL460G Rev	agttgttccccaaatagaaatcgtccgctt	This Study
17	PlyL460E For	tctatttggggaacaactgaatatcctcaggta	This Study
18	PlyL460E Rev	agttgttccccaaatagaaatcgtccgctt	This Study

Custom overlapping primers were designed to introduce site-directed mutations into the coding sequence of Ply.