Skip to main content
. 2013 Mar 15;6:69. doi: 10.1186/1756-3305-6-69

Table 1.

PCR primers and conditions

Generic PCR Primers (5′ -3′) Cycling structure
JVF (forward)
GTTGATCCTGCCAGTATTATATG
95°C for 5 min followed by 40 cycles of 95°C for 30 s, 57°C for 30 s, 72 C for 1 min, 72 C for 7 min
DSPR2 B (reverse)
CACTATTGGAGCTGGAATTAC
JVF (forward)
GTTGATCCTGCCAGTATTATATG
95°C for 5 min followed by 40 cycles of 95°C for 30 s, 50°C for 30 s, 72 C for 1 min, 72 C for 7 min
EntaRev 390* (reverse)
ATTCCTCGTTATCCGTTAT
JVF (forward)
GTTGATCCTGCCAGTATTATATG
95°C for 5 min followed by 40 cycles of 95°C for 30 s, 55°C for 30 s, 72 C for 1 min, 72 C for 7 min
EntaRev417* (reverse) AAAGCTCCTCTCCGATGT

*tagged with biotin at the 3′.