Table 1.
Primers used for the construction of truncated pfJRTS mutants
| Name | Length (bases) | Sequence (5′ ⟶ 3′) | Utilities and description |
|---|---|---|---|
| JRTSΔ232-235 |
28 |
AAAGAATCCCATGGAACAAAATTGTATA |
Sense strand PCR primer for the construction of pET-pfJRTSΔ232-235. Bold-face letters represent Met introduced in front of Glu236. Underlined sequence is the restriction site for NcoI. |
| JRTSΔ232-251 |
28 |
AAAGAATCCCATGGAAAAGAATGATGAC |
Sense strand PCR primer for the construction of pET-pfJRTSΔ232-251. Bold-face letters represent Met-Glu introduced infront of Lys252. Underlined sequence is the restriction site for NcoI. |
| JRTSΔ232-265 |
28 |
AAAGAATCCCATGGAATTTTACAAAAAT |
Sense strand PCR primer for the construction of pET-pfJRTSΔ232-265. Bold-face letters represent Met introduced in front of Glu266. Underlined sequence is the restriction site for NcoI. |
| JRTSΔ232-271 |
28 |
AAAGAATCCCATGGACAAATATAAAATT |
Sense strand PCR primer for the construction of pET-pfJRTSΔ232-271. Bold-face letters represent Met introduced in front of Asp272. Underlined sequence is the restriction site for NcoI |
| JRTSΔ232-274 |
57 |
CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAAATTAAT |
Sense strand PCR primer for theconstruction of pET-pfJRTSΔ232-274. Bold-face letters represent Met introduced in front of Lys275. Underlined sequence is the restriction site for XbaI |
| JRTSΔ232-276 |
57 |
CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAATTATGAA |
Sense strand PCR primer for the construction of pET-pfJRTSΔ232-276. Bold-face letters represent Met introduced in front of Asn277. Underlined sequence is the restriction site for XbaI |
| JRTSΔ232-277 |
57 |
CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGTATGAAAAT |
Sense strand PCR primer to prepare construct pET-pfJRTSΔ232-277. Bold-face letters represent Met introduced in front of Tyr278. Underlined sequence is the restriction site for XbaI |
| JRTSΔ232-299 |
28 |
AAAGAATCCCATGGAAGAGAAAAATAAA |
Sense strand PCR primer to prepare construct pET-pfJRTSΔ232-299. Bold-face letters represent Met introduced in front of Glu300. Underlined sequence is the restriction site for NcoI |
| N3TS | 22 | ACTCATGGATCCTTAAGCAGCC | Antisense strand PCR primer for the construction of all pET-pfJRTS mutants. Underlined sequence is the restriction site for BamHI |