Fig 2.
Muscle size regulations by C1-Ten expression or depletion. (A) (Top) Effect of C1-Ten depletion on S6K1 signaling. si1 (TCAGTGGATTACAACATGACA) and si2 (TCCAGTGGACACAGCACACTG) were used to deplete C1-Ten. Knockdown was done for 24 h on day 6 of differentiation. (Bottom) Levels of C1-Ten protein relative to those of actin (n = 3). con, control. (B) C1-Ten knockdown was performed in myotubes after 6 days of culture. Cells were fixed in 4% paraformaldehyde in PBS for 20 min, washed twice with PBS, and permeabilized with 0.2% Triton X-100 for 5 min. After blocking with 3% bovine serum albumin, cells were stained for the myosin heavy chain with MF20 antibody. Images were obtained with a confocal microscope (LSM-510 Meta; Carl Zeiss, Jena, Germany). Myotube diameter was measured in three spots along a 50-μm length of a myotube. At 48 h after knockdown, the diameters of >50 myotubes were measured and their mean diameters were calculated using ImageJ software. (C) Effect of C1-Ten depletion on atrophy induced by glucocorticoid. C1-Ten knockdown was performed in myotubes after 8 days of culture. After 48 h, cells were stained with myosin heavy chain antibody. Images were obtained using a confocal microscope (LSM-510 Meta). The diameters of over 50 myotubes were measured. P values are compared to C1-Ten siRNA-treated (Dex-positive [Dex +]) cells. (D) The effect of C1-Ten knockdown on glucocorticoid-induced MuRF1 induction was determined by qRT-PCR. Data were normalized to gapdh expression and are presented as the fold induction relative to dexamethasone-untreated [Dex (−)] controls (n = 3). (E) The diameter was determined by infecting myotubes with GFP- or C1-Ten-expressing virus vectors. (Top) Images were taken 60 h after infection using a confocal microscope (LSM-510 Meta). Bars, 100 μm. (Bottom) More than 30 myotubes from independent experiments were measured. (F) (Left) Effect of C1-Ten on FoxO activation; (right) quantification of pFoxO1 and pFoxO3a over FoxO1 (n = 4). (G) Effect of C1-Ten on MuRF1 (n = 6) expression. (H) Effect of C1-Ten on MYH levels (n = 3). *, P < 0.05; **, P < 0.01; ***, P < 0.001.