Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
RT-PCR and qRT-PCR primers used in RNA expression studies
| Gene | RT-PCR type | Forward primer | Reverse primer | PCR product size (bp) |
|---|---|---|---|---|
| gmk (SE0776) | Standard and quantitative | tcaggtgttggaaagggaac | cgcctcaaattcttcctttg | 153 |
| embp (SE1011) | Quantitative | tgacggttccggaagtattg | Ttagctccctgccatctttc | – |
| icaA (SERP2293) | Quantitative | ttatcaatgccgcagttgtc | Accgttggatattgcctctg | – |
