Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2013 Apr 25;7(4):e2179. doi: 10.1371/journal.pntd.0002179

LABCG2, a New ABC Transporter Implicated in Phosphatidylserine Exposure, Is Involved in the Infectivity and Pathogenicity of Leishmania

Jenny Campos-Salinas 1,#, David León-Guerrero 1,#, Elena González-Rey 1, Mario Delgado 1, Santiago Castanys 1, José M Pérez-Victoria 1, Francisco Gamarro 1,*
Editor: Genevieve Milon2
PMCID: PMC3636091  PMID: 23638200

Abstract

Leishmaniasis is a neglected disease produced by the intracellular protozoan parasite Leishmania. In the present study, we show that LABCG2, a new ATP-binding cassette half-transporter (ABCG subfamily) from Leishmania, is involved in parasite virulence. Down-regulation of LABCG2 function upon expression of an inactive mutant version of this half-transporter (LABCG2K/M) is shown to reduce the translocation of short-chain analogues of phosphatidylserine (PS). This dominant-negative phenotype is specific for the headgroup of the phospholipid, as the movement of phospholipid analogues of phosphatidylcholine, phosphatidylethanolamine or sphingomyelin is not affected. In addition, promastigotes expressing LABCG2K/M expose less endogenous PS in the stationary phase than control parasites. Transient exposure of PS at the outer leaflet of the plasma membrane is known to be one of the mechanisms used by Leishmania to infect macrophages and to silence their immune response. Stationary phase/metacyclic promastigotes expressing LABCG2K/M are less infective for macrophages and show decreased pathogenesis in a mouse model of cutaneous leishmaniasis. Thus, mice infected with parasites expressing LABCG2K/M did not develop any lesion and showed significantly lower inflammation and parasite burden than mice infected with control parasites. Our results indicate that LABCG2 function is required for the externalization of PS in Leishmania promastigotes, a process that is involved in the virulence of the parasite.

Author Summary

Leishmania is a protozoan parasite that infects human macrophages, producing the neglected tropical disease known as leishmaniasis. As is the case for apoptotic cells, transient exposure of phosphatidylserine (PS) on the surface of the parasite is required for macrophage engulfment and infection. Although the mechanism involved in this lipid translocation remains unknown, inhibition of PS exposure could therefore prove to be a novel way to combat this parasitic disease. Here, we have identified a new ABC transporter from Leishmania, namely LABCG2, as a protein involved in this process. The dominant-negative inhibition of LABCG2 showed that this transporter is required for the normal exposure of PS on the outer leaflet of the plasma membrane. This altered phenotype was subsequently found to be correlated with a deficient ability to infect mouse peritoneal macrophages. In addition, studies in a mouse model of cutaneous leishmaniasis showed that animals infected with parasites with down-regulated LABCG2 activity did not develop any lesions. Taken together, these results suggest a role for the Leishmania LABCG2 transporter in PS exposure, determining the virulence of the parasite.

Introduction

Leishmaniasis is a neglected disease that is caused by different species of the protozoan parasite Leishmania [1]. This parasite has a digenetic life cycle in which it alternates between promastigote and amastigote stages. Inside the insect (sandfly) vector, non-infective promastigotes are transformed into infective parasites during metacyclogenesis. After the host is bitten by the sandfly, an intense neutrophilic infiltrate into the skin bite sites occurs accompanied by a significant recruitment of macrophages. Afterwards, Leishmania metacyclic promastigotes attach to neutrophils as the initial host cell, and are taken up by phagocytosis [2]. The uptake of infected neutrophils by macrophages is a mechanism for “silent” entry of parasites into macrophages, where they differentiate into the replicative amastigote forms that are responsible for maintenance and propagation of the infection in the phagolysosomal compartment of the mammal host [3], [4].

Phosphatidylserine (PS), a phospholipid (PL) normally asymmetrically confined on the inner leaflet of the plasma membrane of eukaryotic cells [5], seems to play a critical role in the infection of macrophages by Leishmania [6][9]. Indeed, PS exposure on the outer leaflet of the plasma membrane of apoptotic mammalian cells [10] constitutes the most central “eat-me” signal known for macrophages, which also “silent” its activity to avoid an inflammatory reaction [11]. In a process known as apoptotic mimicry, surface exposure of PS in Leishmania promastigotes and amastigotes is required for the infection of new mammalian cells [6], [7] and for down-regulation of the microbicidal activity of macrophages [8], [9], [12] by inhibiting their nitric oxide production and increasing IL-10 synthesis and TGFβ1 secretion [8], [13]. In addition, the well-characterized higher infectivity of the stationary phase promastigotes (metacyclic), as compared to the log phase promastigotes, is also due to the specific exposure of PS on their surface [14], among others factors including the lipophosphoglycan (LPG) or the phosphatidylinositol-anchored surface molecule gp63 [15]. Interestingly, it has been suggested that these PS-exposing promastigotes could be genuine apoptotic cells destined for death [12], [16] instead of apoptotosis-mimicking parasites. Indeed, their presence in the virulent inoculum, in an altruistic behaviour, provides survival advantages for the viable parasites and is necessary for progress of the disease [16]. Recently, it has been demonstrated that PS exposure by intracellular amastigotes of L. amazonensis is associated with a modified host inflammatory response, correlating with parasite infectivity and with clinical parameters of diffuse cutaneous leishmaniasis [17]. Thus, Leishmania parasites able to expose higher amounts of PS, induce a more severe and persistent human disease [17].

The plasma membrane PL asymmetry in eukaryotic cells is maintained due to the bidirectional transport of PL (flip-flop), which involves three protein-mediated activities [18]: i) flippases, which promote active inward-directed PL migration, mediated by aminophospholipid translocases (APT); ii) floppases, which are responsible for the active outward transport of PL from the cytoplasmic to the exoplasmic leaflet of the membrane, mediated by various ATP-binding cassette (ABC) transporters; and iii) scramblases, which are translocases that not require ATP to equilibrate the PL between the two membrane bilayers. PS externalization in apoptotic cells has been suggested to be due to i) a scramblases activity, enhanced by loss of the APT function [19]; and ii) to a higher activity of ABC efflux pumps such as ABCA1 [20]. Additionally, it has been suggested that PS is also delivered to the surface of lysosomes that fuse with the plasma membrane during apoptosis [21]. In the case of Leishmania, a decrease in the active out-to-in PS translocation, thus allowing ATP-independent PS movement, has also been suggested to be responsible for the loss of PL asymmetry [14]. However, disruption of the plasma membrane APT of Leishmania (LdMT) does not lead to an increased infectivity [22], [23]. In addition, although a scramblase activity has been described in Leishmania, its role in parasite infectivity remains to be elucidated [24]. The molecular basis of PS exposure in Leishmania therefore remains unsolved.

Functional ABC transporters consists of two homologous halves, each of which is composed of a transmembrane domain (TMD), which is involved in substrate binding and a cytosolic nucleotide binding domain (NBD), which hydrolyses ATP to provide the energy required for the transport [25]. The ATP sites are reconstituted upon dimerization of both NBDs, which pack together in a head-to-tail configuration to generate two ATP binding and hydrolysis sites between the conserved Walker A and B motifs of one NBD and the signature motif of the other [26]. ABC half-transporters with a single NBD therefore require homo-/heterodimerization to reconstitute the ATP sites. Members of the ABCA, ABCB and ABCG human subfamilies have been implicated in PL translocation [18], [27]. For example, human ABCG2 (BCRP/MXR/ABCP), a protein involved in multidrug resistance in cancer cells [28], [29], is responsible for enhanced exposure of PS at the plasma membrane of ABCG2 overexpressing cells due to increased outward PS transport [30]. Members of the ABCG subfamily of half-transporters have been identified in Leishmania [31], and three of these have already been functionally characterized. Thus, LABCG4 is localized at the plasma membrane of the parasite and is involved in the translocation of phosphatidylcholine (PC) analogues; it also confers resistance to alkyl phospholipids [32]. LABCG6 is also localized at the plasma membrane and is probably involved in PL trafficking as it reduces the accumulation of PL analogues of PC, phosphatidylethanolamine (PE) and PS [33], and confers resistance to camptothecin [34], miltefosine and sitamaquine [33]. LABCG5, in contrast, is not involved in the translocation of PL at the plasma membrane or drug resistance but participates in salvage of the heme released after the breakdown of internalized haemoglobin [35]. Additionally, it has been reported that other Leishmania ABC transporters such as LABCB4 [36], LABCA1 [37] and LABCA2 [38] are involved in PL translocation.

The aim of our work was to study the functionality of the transporter LABCG2 from Leishmania, specifically its involvement in PS translocation and its implication in parasite virulence. The results show that down-regulation of LABCG2 produces a defect in the exposure of endogenous PS at the external surface of the parasite, and that this defect correlates with a significant decrease in the ability of these parasites to infect mouse peritoneal macrophages and to produce pathology in a mouse model of cutaneous leishmaniasis.

Materials and Methods

Materials

3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT), PMSF (phenylmethylsulfonyl fluoride), DFP (diisopropylfluorophosphate), monoclonal anti α-tubulin, and amphotericin B were obtained from Sigma Chemical Company (St. Louis, USA). Anti-histone H2A was courtesy of Dr. Stephen M. Beverley (Washington University, School of Medicine, St. Louis, Missouri, USA). Polyclonal anti-GFP antibody was from Rockland Company. Mouse monoclonal anti-gp63 was from Life Span BioSciences. Polyclonal antisera against metacyclic marker protein HASPB was a kind gift from Dr. Deborah F. Smith (University of York, UK). The fluorescent analogues 1-palmitoyl-2-[6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]hexanoyl-sn-glycero-3-phosphocholine (NBD-PC), -phosphoethanolamine (NBD-PE), -phosphoserine (NBD-PS) and 6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino-hexanoyl-sphingosine-1 phosphocholine (NBD-sphingomyelin; NBD-SM) were purchased from Avanti Polar Lipids (Birmingham, AL, USA). Annexin V-Alexa 488, FM4-64, concanavalin A-Alexa Red, MitoTracker Deep Red 633, Cell Tracker TM Green and DAPI were from Molecular Probes (Invitrogen, Carlsbad, CA). Ro-peptide (Ro09-0198), a tetracyclic peptide antibiotic, was kindly provided by Dr. Masato Umeda (The Tokyo Metropolitan Institute of Medical Science, Japan). Papuamide B (Flintbox, LynseyHuxham), a novel depsipeptide obtained from extracts of marine sponges, was kindly provided by Dr. Thomas Gunther Pomorski and Dr. Rosa López (Department of Plan Biology and Biotechnology, University of Copenhagen, Denmark). Peanut agglutinin (PNA) and fluorescein-conjugated ricin agglutinin was purchased from Vector (Burlingame, CA). The plasmids pXG-GFP+2′ and pXG-'GFP, which can be used to express GFP fusion proteins in Leishmania with GFP at either the N- or the C-terminus, respectively, were kindly provided by Dr. Stephen M. Beverley.

Leishmania strains and cell cultures

Promastigote forms of Leishmania major clone V1 (MHOM/IL/80/Friedlin), Leishmania infantum (MHOM/ES/1993/BCN-99) and Leishmania donovani (MHOM/ET/67/HU3) were maintained in vitro at 28°C in modified RPMI-1640 medium (Invitrogen, Carlsbad, CA) supplemented with 20% heat-inactivated foetal bovine serum (hiFBS, Invitrogen), as described previously [37], [38]. To determine parasite sensitivity to the toxic peptides papuamide B and Ro-peptide, and to amphotericin B, 106/mL parasites were incubated in RPMI-1640 containing different concentrations of peptides and the parasite viability determined by MTT analysis after 72 h, as described previously [39].

DNA constructs and cell transfection

LABCG2 (GeneDB-L. major, Accession Code LmjF06.0090) was isolated from the genomic DNA of L. major by PCR using sense (5′- ATATCGCTGTCTCTGCGTCG) and antisense (5′- GGCAAACACACAGAGCGATG) primers. The nucleotide sequences were determined automatically as previously described [40]. To obtain parasites expressing non-functional LABCG2, a mutation was introduced in the Walker A motif of the ATP binding domain, replacing lysine 108 with a methionine (K108M) using the QuikChange XL Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The resulting mutated gene LABCG2K108M (LABCG2K/M) was cloned into the Leishmania expression vector pUCNeoPlus [37]. The vector pXG-GFP+2′ was used to create GFP- LABCG2 and -LABCG2K/M versions with GFP fusions at N-terminus [41]. The LABCG2 and LABCG2K/M open reading frame for these N-terminus tagged versions was amplified by PCR using sense (5′-GCGGCCGCATGCCCCCTCCCGCAGCAACACGTGC) and antisense (5′-GCGGCCGCTCATGCCGTTCTCGCACAGCTCGCCA) primers. For the C-terminus tagged versions, LABCG2 and LABCG2K/M were cloned in a pXG-'GFP+ using sense (5′-ACCGGTATGCCCCCTCCCGCAGCAACACGTGC) and antisense (5′- GATATCTGCCGTTCTCGCACAGCTCGCCACGG) primers. Promastigotes of L. major were transfected with the different constructs and selected for G-418 resistance as described previously [42].

Gene expression analysis

Total RNA was prepared from control (empty vector) and LABCG2K/M expressing promastigotes using the total RNA isolation kit (Roche Biochemicals). cDNA was synthesized from 60 ng of total RNA using Superscript II TM RNaseH Reverse Transcriptase (Invitrogen) and oligo (dT)12–18 primers (Invitrogen) following the manufacturer's instructions. Semi-quantitative PCR was performed with 50 µL aliquots using 50 pmol each of sense and antisense primers corresponding to LABCG2 and LmGAPDH using the following profile: initial denaturation at 95°C for 5 min followed by 25 cycles with denaturation at 95°C for 1 min, annealing at 54°C for 30 s and extension at 68°C for 35 s, with a final extension of 5 min.

Fluorescence microscopy of Leishmania promastigotes

For endosome/lysosomal labelling, 107 stationary-phase promastigotes obtained after 4 day culture were incubated in 1 mL of RPMI 1640 medium containing 50 µg/mL of concanavalin A-Alexa Red for 2 h at 28°C or with 1 µM FM4-64 for 30 min at 28°C or 4°C. For mitochondrial labelling, 107 stationary-phase promastigotes were stained with 50 nM MitoTracker Deep Red 633 for 30 min at 28°C and then washed in ice-cold phosphate-buffered saline (PBS; 1.2 mM KH2PO4, 8.1 mM Na2HPO4, 130 mM NaCl and 2.6 mM KCl adjusted to pH 7). Parasites were fixed for 30 min at 4°C with 2% paraformaldehyde and then observed under a microscope. Images (one stack) were acquired using an Olympus IX81 microscope and deconvolved using Huygens Professional.

Analysis of fluorescent PL uptake

The NBD-phospholipid accumulation was determined by flow cytometry as described previously [43]. Briefly, stationary-phase promastigotes (107/mL) were incubated in HPMI buffer (20 mM HEPES, 132 mM NaCl, 3.5 mM KCl, 0.5 mM MgCl2, 5 mM glucose, 1 mM CaCl2, pH 7.4) supplemented with 0.3% (w/v) BSA for 30 min at 28°C, then labelled with 10 µM NBD-PC, 10 µM NBD-PE, 10 µM NBD-SM or 30 µM NBD-PS for 30 min at 28°C. HPMI was supplemented with either 500 µM PMSF or 5 mM DFP to block the catabolism of NBD-lipids [43]. Parasites were washed twice with ice-cold PBS, supplemented with 0.3% BSA and resuspended in PBS for flow cytometry analysis, using a Beckton Dickinson FACScan (San José, CA) equipped with an argon laser operating at 488 nm.

Measurement of NBD-PS outward transport in L. major lines

To measure the NBD-PS outward transport from the cytoplasmic to the exoplasmic leaflet, Leishmania stationary-phase promastigotes (107/ml) were labeled with 30 µM (control parasites) or 15 µM (LABCG2K/M) NBD-PS for 30 min at 28°C in HPMI buffer (20 mM HEPES, 132 mM NaCl, 3.5 mM KCl, 0.5 mM MgCl2, 5 mM glucose, 1 mM CaCl2, pH 7.4) supplemented with 0.1% (w/v) BSA to allow that inward movement of the NBD analogue was equally, as previously described [30]. Afterwards, NBD-PS remaining on the cell surface was extracted twice by incubation with 2% (w/v) BSA in HPMI (supplemented with 5 mM glucose and 500 µM PMSF) for 5 min on ice. Before starting the outward transport assay, the medium was removed and parasites were washed with ice-cold PBS. For t = 0 min, the cells were resuspended in HPMI (supplemented with 2% BSA, 5 mM glucose and 500 µM PMSF). Time dependent outward transport was monitored at 28°C at different time points (5, 15, 30, 60 min) in the supernatants and the samples were analyzed by SLM-Aminco 8000C spectrofluorimeter.

Annexin V- binding assay

Leishmania promastigotes were harvested in RPMI-1640 and centrifuged at 2500× g for 10 min at 4°C. The cells were washed with Annexin V-binding buffer (20 mM HEPES, 132 mM NaCl, 3.5 mM KCl, 5 mM CaCl2 and 0.5 mM MgCl2, pH 7.4 and 10 mM glucose), then resuspended in the same buffer and incubated with Annexin V–Alexa 488 (1/20 dilution; at the concentration indicated by the manufacturer) at 4°C for 15 min. The parasites were subsequently labelled with propidium iodide (0.4 µg/ml) and the mixture incubated for 5 min at 4°C. The cells were washed for 1 min at 2500× g and 4°C, and resuspended to a cell density of 4×106 cells/mL. Controls measurements in the absence of calcium were included using Annexin V–Alexa 488 plus 8 mM EGTA. Cellular fluorescence was quantified by scanning the emission in a FACSCalibur and analysed using the Cell Quest Pro software application. A total of 10,000 events were harvested from each sample. The control cells were incubated in Annexin V-binding buffer alone, without Annexin V–Alexa 488, under identical conditions.

In vitro infection of mouse peritoneal macrophages

Peritoneal macrophages from BALB/c mice (Charles River Ltd.) were harvested by lavage with ice-cold RPMI 1640 medium, plated at a density of 5×105 macrophages/well in RPMI-1640 medium plus 10% hiFBS in 24-well plates provided with glass coverslips (22 mm2) and allowed to adhere for 4 h at 37°C under 5% CO2, as described previously [7], [8]. The adherent macrophages were infected at 35°C with stationary-phase promastigotes of control and LABCG2K/M-expressing L. major parasites with or without Annexin V (0.05 µg/µl×107promastigotes), at a parasite-to-cell ratio of 5∶1 in RPMI-1640 medium supplemented with 5% hiFBS. After 4 h of infection, unphagocytosed parasites were removed by washing with serum-free medium. The infected macrophages were further incubated in RPMI 1640 medium supplemented with 10% hiFBS for 24 h at 37°C in a 5% CO2 atmosphere. Following incubation, the cultures were fixed with 2% paraformaldehyde/glucose, stained with DAPI and the rate of infected macrophage analyzed using images acquired with an Olympus IX81 microscope as described previously [44]. Parasites were quantified using a cell counter provide with the Image J software (http://rsb.info.nih.gov/ij/). The images were deconvolved using Huygens Professional from Scientific Volume Imaging (http://www.svi.nl). The percentage of macrophage infection was calculated by dividing the number of infected macrophages by the number of counted macrophages. The mean number of amastigotes per infected macrophage was determined by dividing the total number of amastigotes counted by the number of infected macrophages. Three independent experiments were performed with duplicates.

Leishmania binding assays

The interactions between L. major stationary-phase promastigotes and mouse peritoneal macrophages were measured as previously described with some modifications [22]. Mouse peritoneal macrophages (5×105/well), maintained at 37°C with 5% CO2 in RPMI 1640 medium supplemented with 10% of hiFBS, were labeled with 5 µM FM4-64 for 30 min at RT in RPMI 1640 medium. LABCG2K/M and control L. major promastigotes (107/ml) in stationary phase were labeled with 1 µM Cell Tracker TM Green for 40 min at 28°C in RPMI 1640 medium. Then, parasites and peritoneal macrophages were washed four times in RPMI 1640 medium and finally resuspended in RPMI 1640 medium supplemented with 5% of hiFBS. Binding assays were performed using a parasite∶macrophage ratio of 5∶1. Promastigote forms of L. major lines were added to the monolayer cells. After 4 h incubation at 37°C, unbound promastigotes were removed by thorough washing. The monolayers and bound promastigotes were analysed by a Confocal Leyca SP5 microscopy. All the experiments were done in triplicate.

LPG and gp63 surface expression analysis

Expression analysis of the surface molecule LPG was performed as described previously [45]. Thus, stationary-phase promastigotes (107/mL) were washed twice with PBS and incubated with 5 µg/mL fluorescein-conjugated ricin agglutinin in PBS for 10 min at 28°C, then washed with PBS and analyzed by flow cytometry using a FACSCalibur (Beckton Dickinson). For quantification of cell surface gp63, parasites were incubated with a 1∶500 dilution of a mouse monoclonal anti-gp63 on ice. The cells were subsequently washed with PBS supplemented with 0.1% BSA and fixed at 4°C in 2% paraformaldehyde for 20 min, then washed again and incubated at room temperature with a 1∶500 dilution of FITC fluorescein isothiocyanate-labeled goat anti-mouse immunoglobulin G (Sigma). These cells were washed three times with PBS-0.1% BSA and the parasite-associated fluorescence was analyzed by flow cytometry using a FACSCalibur.

Metacyclic purification assay

Metacyclic promastigotes were isolated from stationary cultures of L. major promastigotes by negative selection using a previously described peanut agglutinin (PNA) methodology [46]. Briefly, stationary-phase promastigotes were collected after culture for 4 days, washed with PBS and then incubated with 100 µg/mL of PNA. After incubation for 10 min at room temperature, cells were separated by centrifugation at 500× g for 10 min. The non-agglutinated promastigotes (metacyclic) collected in the supernatant were washed twice with PBS and resuspended in PBS for further experiments.

Western blot analysis

Proteins from whole stationary-phase promastigotes (107/well) were resolved in 10% SDS-PAGE and electroblotted onto PVDF membranes. Western blot analysis was performed as described previously [47], using a polyclonal antibody against metacyclic promastigote protein HASPB (1∶2000) or GFP (1∶5000; Invitrogen), followed by detection with a horseradish peroxidase-conjugated secondary goat anti-rabbit IgG (1∶5000; Dako Denmark) antibody. Monoclonal antibodies against H2A histone or α-tubulin (1∶5000 or 1∶10000; Sigma-Aldrich) were used to confirm equivalent protein loading. Detection was carried out by enhanced chemiluminescence reaction using the ECL kit (Amersham).

Analysis of in vivo infection

Six-week-old female BALB/c mice were purchased from Charles River Breeding Laboratories and maintained in the Animal Facility Service of our Institute under pathogen-free conditions. Animals (10 mice/group) were injected subcutaneously in their left hind footpads with 104 L. major purified metacyclic promastigotes resuspended in PBS, as described above. Disease progression was monitored by measuring the inflammation edema and the area of the cutaneous lesion of the infected footpad using a digital caliper (Mitutoyo, Japan), in comparison with the values obtained in the uninfected contralateral footpad. Parasite burdens in target tissues were determined from the presence of amastigotes isolated from footpad, spleen and lymph nodes at week five post-infection, after tissue homogeneization and culture in promastigote culture medium, using a limiting dilution assay, as described previously [48].

Ethics statement

All experiments were performed according to the National/EU Guidelines for the Care and Use of Laboratory Animals in Research and the approval of the Ethics Committee of the Spanish National Research Council (CSIC, file CEA-213-1-11).

Statistical analysis

Statistical comparisons between groups were performed using Student's t test. Differences were considered significant at a level p<0.05.

Results

Sequence features of LABCG2 and generation of a Leishmania line expressing an inactive version of the protein

LABCG2 (GeneDB-L. major, accession code LmjF06.0090) has two additional tandem imperfect repeats in chromosome 6 of Leishmania (LABCG1, accession code LmjF06.0080, and LABCG3, accession code LmjF06.0100) [31]. LABCG1, LABCG2 and LABCG3 are “half-transporters” with a single NBD and a single TMD localized at their C-terminus (Appendix in Supporting information, Fig. S1A). LABCG1 and LABCG2 codes for a 657 and 663 amino acid protein, with a predicted molecular weight of approximately 73.4 and 74.0 kDa, respectively. LABCG1 and LABCG2 are almost identical (95.7% of identity). LABCG3 protein is truncated, with Walker A and several transmembrane segments being absent (Appendix in Supporting information, Fig. S1B). LABCG2 shares 19.5% amino acid identity with human ABCG1, 24.6% with human ABCG2 and 27.3% with the White protein from Drosophila [35].

The dimerization requirement for ABC half-transporters (such as LABCG2) to become functional led us to test a dominant-negative approach to down-regulate LABCG2 function, as recently described for Leishmania LABCG5 [35]. To this end, we first mutated in LABCG2 the lysine residue inside the Walker A motif (108 position), which is known to be critical for ATP hydrolysis in ABC transporters [35], [49], to a methionine (K108M). The expression of other ABCG half-transporters with a similar K/M substitution produces a dominant-negative inhibition in the wild-type transporters [35], [50]. The resulting construct was transfected into L. major and the expression of LABCG2K108M (LABCG2K/M) was verified by RT-PCR (Appendix in Supporting information, Fig. S2A). In contrast to the phenotype observed after LABCG5K/M expression [35], parasites transfected with LABCG2K/M grew at normal rates (Appendix in Supporting information, Fig. S2B).

Subcellular localization of LABCG2

To study the localization of LABCG2, we fused LABCG2 and LABCG2K/M with an N-terminal GFP-tag. These constructs were transfected into L. major promastigotes and expression of these proteins determined by Western-blot analysis of whole parasite lysates. As expected, a band corresponding to GFP-LABCG2 was observed at around 100 kDa (Appendix in Supporting information, Fig. S3A). Additional higher molecular weight signals could correspond to dimeric forms of the protein, as described for LABCG5 [35], whereas the lower bands probably correspond to degraded proteins.

Fluorescence microscopy studies showed that GFP-LABCG2 partially overlap with the endosomal markers FM4-64 [51] and concanavalin A [52] in the stationary growth phase promastigotes, which is depicted in representative micrographs in Fig. 1A and 1C. In contrast, the stained vesicular structures do not co-localize with the mitochondrial marker MitoTracker (data not shown). The localization pattern of the protein does not change when GFP-LABCG2K/M was expressed in Leishmania parasites (Fig. 1B and 1D). To evaluate whether GFP-LABCG2 was also localized in the flagellar pocket, the sole site for endo-/exocytosis in Leishmania, we subsequently performed the co-localization experiments with FM4-64 at 4°C to block its vesicular trafficking. The results showed that GFP-LABCG2K/M co-localizes in the flagellar pocket of the stationary-phase promastigotes (Fig. 1E, yellow arrows). Another part of the GFP-LABCG2K/M pool was detected in intracellular vesicles localized in the apical part of the cell, at the tip of the aflagellar pole of the parasite (Fig. 1E), a site that is known to be involved in the interaction with host cells [53]. GFP-tagged LABCG2 protein at the COOH-terminal showed a similar pattern of localization (Appendix in Supporting information, Fig. S3B), but its expression was unstable after few culture passages, thus suggesting that the C-terminal TMD region is critical for maintaining LABCG2 stability. Overall, these studies suggest that LABCG2 localizes to intracellular vesicles of the endosomal pathway, at the flagellar pocket and at the aflagellar pole of Leishmania.

Figure 1. LABCG2 localizes to the intracellular vesicles of Leishmania parasites.

Figure 1

L. major stationary promastigotes transfected with GFP-LABCG2 (A and C) and GFP-LABCG2K/M (B and D) were incubated at 28°C with 1 µM FM4-64 (A and B) and 50 µg/mL concanavalin A-Alexa Red (C and D) for 30 min and 120 min, respectively. (E) LABCG2K/M localizes into the flagellar pocket of Leishmania parasites. L. major stationary promastigotes transfected with GFP-LABCG2K/M were incubated with 1 µM FM4-64 for 30 min at 4°C. The parasites were fixed for 10 min in 2% with paraformaldehyde at 4°C. (a) Nomarski images of b, c, d and e. Representative co-localization sites (f) are indicated by yellow arrows in the merged images. Scale bar: 5 µm. N (nucleus) and K (kinetoplast) are stained with DAPI. FP: flagellar pocket; AP: aflagellar pole. The figure illustrates a representative parasite of a total population of parasites with a similar fluorescence pattern.

LABCG2 is involved in the exposure of PS on the outer surface of Leishmania

To study the possible role of LABCG2 in PL transport, we first investigated the accumulation level of fluorescent short-chain PL analogues by flow cytometry. Thus, stationary-phase L. major promastigotes transfected with the empty vector (control) or the vector containing LABCG2K/M (LABCG2K/M parasites) were incubated with NBD-PE, -PC, -PS and -SM, and the cell-associated fluorescence analyzed by flow cytometry after back-exchange with BSA to extract the NBD-PL located in the outer plasma membrane leaflet. Under these conditions, accumulation of NBD-PS by the LABCG2K/M parasites was significantly higher than that observed for control cells (4.2 fold, n = 12, p<0.05; Fig. 2A). In contrast, no significant differences were observed for NBD-PC, NBD-PE and NBD-SM accumulation between control and LABCG2K/M parasites (Fig. 2B–D). The change in NBD-PS accumulation was not due to differences in endocytosis, as the internalization of NBD-SM, which is taken up by this process, was not affected by the functionality of LABCG2 (Fig. 2D). The above results were validated in a second transfection event with LABCG2K/M (Fig. 2E). To verify that the higher NBD-PS accumulation observed was due to the dominant-negative inhibition of LABCG2 activity, LABCG2K/M parasites were cured for the plasmid pUCNeoplusLABCG2K/M (reverted line) by culturing the parasites in the absence of plasmid drug selection pressure for three months. This reverted line showed a similar NBD-PS accumulation to the control line (Fig. 2F). We subsequently tested whether LABCG2 was involved in NBD-PS internalization in two other Leishmania species (L. infantum and L. donovani). Down-regulation of LABCG2 function was also assayed by expressing LABCG2K/M and a similar phenotype was observed in these Leishmania species (Appendix in Supporting information, Fig. S4A and B). To confirm that the higher accumulation of NBD-PS in the LABCG2K/M parasites was due to a reduced floppase activity, we measured the outward translocation of NBD-PS from the cytoplasmic to the exoplasmic leaflet of the plasma membrane in both Leishmania lines. Thus, control and LABCG2K/M L. major promastigotes were loaded under conditions that yielded similar amounts of intracellular NBD-PS after the back-exchange step. Then, parasites were maintained in probe-free culture medium containing BSA and the amount of NBD-PS extracted from the external side of the plasma membrane was measured at different time points. The results showed that the outward translocation of NBD-PS was higher in control versus LABCG2K/M promastigotes (Fig. 2G) suggesting a PS floppase activity of LABCG2.

Figure 2. Fluorescent PL accumulation in Leishmania parasites.

Figure 2

Stationary promastigotes of Leishmania were incubated with the fluorescent PL analogues NBD-PS (A), NBD-PC (B), NBD-PE (C) or NBD-SM (D) for 30 min at 28°C. After washing and back-exchange with BSA, cell-associated fluorescence was measured by flow cytometry analysis. The grey histogram represents control cells transfected with the empty vector, the uncoloured histogram represents parasites expressing LABCG2K/M and the dotted histogram represents non-labelled cells. (E) NBD-PS accumulation in Leishmania lines after a second transfection event. The reverted line (F), which was maintained for 3 months without drug pressure, was also included. The histograms correspond to a representative experiment from three independent experiments. (G) Outward transport of NBD-PS in Leishmania parasites. Stationary promastigotes of control (black circles) and LABCG2K/M (black squares) Leishmania lines were incubated with the fluorescent analogue NBD-PS for 30 min at 28°C. After washing and back-exchange with BSA, cells were incubated for different time points in a free NBD-PS medium containing BSA and the fluorescence of the supernatant was measured by spectrofluorimetry. Results represent the means ± SD of four independent duplicated experiments. * P<0.05 vs. control parasites.

Next, we studied the translocation of endogenous, long-chain PS labelling control and LABCG2K/M stationary growth phase promastigotes with Annexin V-Alexa Fluor 488. This probe binds PS exposed in mammalian apoptotic cells [8] and Leishmania promastigotes in a calcium dependent manner [16] (Appendix in Supporting information, Fig. S5). Quantitative analysis by flow cytometer (Fig. 3A) showed that LABCG2K/M parasites presented a significantly reduced exposure of PS in the outer leaflet of the plasma membrane compared with control cells (20.1% vs. 52.7% of Annexin V positive/propidium iodide negative, respectively, p<0.05). Additionally, we determined that the density of PS molecules on the cell surface is significantly higher in the control (53.35±6.12) than in the LABCG2K/M parasites (38.10±3.49), as measured by the mean fluorescence intensity (Fig. 3B); however, control and LABCG2K/M log phase parasites showed a low and similar Annexin V-binding (10.97% vs. 11.06% of Annexin V positive/propidium iodide negative, respectively, p<0.05; data not shown). These results were supported by RT-PCR analysis of expression of LABCG2 through the life cycle of L major that shows higher expression of LABCG2 in stationary growth phase/metacyclic promastigotes versus log phase parasites (Fig. 3C and 3D). To validate that the differences in Annexin V-Alexa Fluor 488 labelling were due to a defect in PS exposure, we tested the sensitivity of control and LABCG2K/M parasites to papuamide B, a pore-forming cytolytic peptide that specifically binds to PS at the external surface of the plasma membrane [54]. The results showed that LABCG2K/M parasites were less sensitive to papuamide B than controls (EC50 = 3.26±0.67 µM vs. EC50 = 2.12±0.33 µM, p<0.05, respectively) (Fig. 4A). As a control experiment, we tested the sensitivity of both lines to Ro-peptide, which strictly recognizes PE residues at the external surface of biological membranes [55]. The results of this study indicated that there were no differences in sensitivity between LABCG2K/M and control parasites (EC50 = 1.58±0.09 µM vs. EC50 = 1.64±0.12 µM, respectively) (Fig. 4B). These results are in agreement with the absence of alterations in NBD-PE translocation in LABCG2K/M parasites. Several ABCG transporters have been implicated in sterol transport [56]. Thus, differences in papuamide B sensitivity might be indirectly caused by a general change in membrane lipid organization in LABCG2K/M parasites. We study this possibility by analyzing both sensitivity of control and LABCG2K/M parasites to amphotericin B; the results shown that there were no significant differences in sensitivity of both lines to amphotericin B (Fig. 4C), suggesting that LABCG2 does not contribute greatly in the distribution of sterols into the plasma membrane. Finally, we confirmed that the parasites expressing GFP-LABCG2K/M used for the subcellular localization analysis also maintained their papuamide B resistance phenotype (data not shown).

Figure 3. The externalization of endogenous PS by stationary Leishmania promastigotes depends on LABCG2 function.

Figure 3

(A) PS exposure at the outer leaflet of the parasite plasma membrane was analyzed by flow cytometry using Annexin V–Alexa 488 as described in Materials and Methods. The lower right quadrant in the density plots represents the percentage of Annexin V positive/Propidium iodide negative in control or LABCG2K/M parasites. Markers were placed using non-stained parasites. (B) Density of PS molecules (GeoMean) on the cell surface. The grey histogram represents control cells transfected with the empty vector, the uncoloured histogram represents parasites expressing LABCG2K/M and the dotted histogram represents non-labelled cells. The results shown are representative of three independent duplicated experiments. (C and D) Gene expression analysis of LABCG2 from L. major control determined by RT-PCR analysis through the different growth phases of Leishmania parasites: early log (day 2), late log (day 3), stationary (day 4) and late stationary phase (day 5). RT-PCR was carried out for 35 cycles using RNA isolated from the above parasites and the products were run in 2% agarose gel as described in Materials and Methods. Lower imagine in C shows the expression of GADPH used as internal loading control. The arrows indicate amplified 280 bp LABCG2 fragment and 227 bp GADPH fragment. Lower imagine in D shows the mRNA level of LABCG2 normalized with GADPH in different points of the growth curve. The results shown are the means of three independent experiments ± SD.

Figure 4. Leishmania LABCG2K/M parasites present resistance to papuamide B.

Figure 4

Sensitivity of control and LABCG2K/M parasites to the PS-binding peptide papuamide B (A), PE-binding peptide Ro09-0198 (B) and amphotericin B (C). Logarithmic-phase promastigotes were diluted to 106/mL in RPMI 10% hiFBS containing different concentrations of these peptides; after 72 h, cell viability was analysed by a MTT analysis as described in Materials and Methods. Results represent the means ± SD of four independent duplicated experiments. * P<0.05 vs. control parasites.

Down-regulation of LABCG2 function decreases in vitro parasite infectivity

As PS externalization by the parasite is a key mediator for infection of the macrophages [12] and polymorphonuclear cells [16], we evaluated whether down-regulation of LABCG2 function correlated with a decreased infectivity of the parasites. Thus, we measured the ability of control and LABCG2K/M stationary-phase promastigotes to infect mouse peritoneal macrophages. The results showed that whereas 80% of macrophages were infected by control parasites after 24 h post-infection, only 20% of cells were infected by LABCG2K/M parasites (Fig. 5A). In contrast, the number of parasites per infected macrophage was similar in both cases (Fig. 5B). We have shown that the different infectivity values observed in LABCG2K/M parasites are not due to differences in the interaction parasite-macrophages as determined after 4 hours post-infection binding assays (Appendix in Supporting information, Fig. S6A and B. The results showed there were not differences in the percentage of interaction in control cells (80.50±5.77) compared with LABCG2K/M parasites (84.33±7.35). Additionally, we have determined that the overexpression of LABCG2 in Leishmania parasites did not show differences in the PS exposition nor in the % infectivity of mouse peritoneal macrophages (data not shown).

Figure 5. LABCG2K/M parasites are less infective to mouse peritoneal macrophages.

Figure 5

Infection of mouse peritoneal macrophages with stationary Leishmania promastigotes from control and LABCG2K/M parasites was performed as described in Materials and Methods. The percentage of infected macrophages (A) and the mean number of parasites per macrophage (B) were determined 24 h post-infection. The results represent the means ± SD of three independent experiments. *P<0.05 vs. infection level of control parasites. Additionally, the effect of Annexin V-binding on macrophage infectivity was determined (C) using control and LABCG2K/M stationary parasites incubated in the presence (+) or absence (−) of Annexin V (0.05 µg/µl×107 stationary promastigotes) for 4 h. The results shown are the means of three independent experiments ± SD. *P<0.05 untreated control vs.: Annexin V-treated control, untreated LABCG2K/M parasites and Annexin V-treated LABCG2K/M parasites.

We have repeated the infection experiments masking most of the PS in the metacyclic forms by incubating stationary-phase control and LABCG2K/M parasites with Annexin V. As expected, PS masking reduced the macrophage infection percentage of control parasites by approximately 82%. Annexin V-mediated masking of PS in LABCG2K/M parasites did not significantly altered their lower ability to infect peritoneal macrophages, reaching similar values to those obtained with Annexin V treated control parasites (Fig. 5C). Furthermore, we assessed whether other molecules, such as lipophosphoglycan (LPG) or the phosphatidylinositol-anchored surface molecule gp63 [15], both of which are implicated in Leishmania infectivity, could be altered in LABCG2K/M parasites. Flow cytometry analysis of stationary-phase promastigotes marked with fluorescein-conjugated ricin agglutinin, which specifically label LPG [45], showed no differences between control and LABCG2K/M parasites (Appendix in Supporting information, Fig. S6C). Additionally, flow cytometry analysis using a specific monoclonal antibody for Leishmania gp63 showed no significant differences between expression of this surface molecule in the control and LABCG2K/M stationary-phase promastigotes (Appendix in Supporting information, Fig. S6D). Finally, we evaluated whether the infectivity differences observed may be due to an alteration in the metacyclogenesis of the parasites produced by down-regulation of LABCG2 function. Thus, we purified infective metacyclic forms from stationary-phase promastigotes of control and LABCG2K/M parasites by binding to the lectin peanut agglutinin (PNA) [57], and found that the percentage of metacyclic parasites (PNA) obtained was similar in both cell lines (Appendix in Supporting information, Fig. S7A). Furthermore, both parasite lines were morphologically elongated, highly mobile, there were no rounded shapes and differences in size (FSC-H) between control (427.26±13.82) and LABCG2K/M (413.61±14.53) lines, respectively (Appendix in Supporting information, Fig. S7B). We also analysed expression of the metacyclic marker protein HASPB (hydrophilic acylated surface protein B) [58], which is implicated in host-cell infection. Western blot analysis indicated that there were no differences in expression of this 32 kDa protein between control and LABCG2K/M parasites (Appendix in Supporting information, Fig. S7C).

LABCG2 is required for disease development in a mouse model of cutaneous leishmaniasis

As down-regulation of LABCG2 function decreased the in vitro macrophage infectivity of metacyclic parasites, we analysed whether this defect was correlated with a lower in vivo virulence of the parasites using a mouse model of cutaneous leishmaniasis. Thus, susceptible female BALB/c mice were infected with 104 metacyclics purified from control and LABCG2K/M parasites by footpad inoculation. As we had previously observed during the assays to cure LABCG2K/M parasites for the plasmid pUCNeoplusLABCG2K/M (reverted line) that the defect on the externalization of NBD-PS remained unaltered for at least five weeks in the absence of antibiotic pressure, we were able to use transfected parasites for this model. After infection, the measure of inflammation and the development of skin lesions in the footpad with time were monitored weekly up to a maximum of five weeks. At this time, control animals had to be sacrificed due to the severity of the lesions. Mice infected with control parasites showed progressive inflammation and lesion pathology after the first two weeks (Fig. 6A–C), whereas mice infected with LABCG2K/M parasites showed no detectable lesions pathology at any time, and presented significantly lower footpad inflammation (Fig. 6A–C). As observed in Fig. 6B, the curve for footpad lesion size is the same for non-infected control animals and for the animals infected with LABCG2K/M L. major metacyclic parasites, which shows no lesions during the time of the infection assay.

Figure 6. LABCG2K/M parasites are less infective in a cutaneous leishmaniasis mouse model.

Figure 6

Susceptible BALB/c mice were infected with 104 control and LABCG2K/M L. major metacyclic parasites as described in Materials and Methods. Disease development was monitored weekly by measuring the inflammation (A) and lesion size (B). The pictures in C show the lesion at week 5 post-infection. Parasite burden was determined in footpad (D) and tissues (E): lymph nodes (LN) and spleen (SP). The results represent the means ± SD of three independent experiments, with 10 mice per group. Mice were euthanized when the lesion size in controls reached a value of 50–70 mm2. * P<0.05 vs. control parasites; n.d. stands for not detected.

Additionally, we decided to determine whether these infected mice presented parasites in different target tissues and whether these parasites maintained the expression of LABCG2K/M and increased NBD-PS accumulation. Thus, at the indicated time, mice were euthanized and their footpad, spleen and lymph nodes collected for parasite isolation following the limiting dilution assay. As can be seen from Fig. 6D–E, a lower parasite burden was recovered from the footpad of mice infected with the LABCG2K/M parasites compared to the control mice (Fig. 6D), and no parasites were isolated from the spleen or lymph nodes of mice infected with the LABCG2K/M parasites (Fig. 6E) after one week of in vitro culture. Moreover, we confirmed by RT-PCR that the mutant LABCG2K/M gene was still expressed in parasites isolated from the footpad of mice infected with the LABCG2K/M parasites (Fig. 7A), and that its phenotype of increased NBD-PS accumulation remained unaltered (Fig. 7B). To confirm that the loss of virulence exhibited by the mutant line was due to the expression of LABCG2K/M, these experiments were repeated with a second line of LABCG2K/M parasites generated from an independent transfection event. The results of this study were similar to those described above (Appendix in Supporting information, Fig. S8 ), thus indicating that the dramatic differences in the virulence of LABCG2K/M parasites were due to down-regulation of LABCG2 function and suggesting that the Leishmania LABCG2 gene is crucial for disease development.

Figure 7. LABCG2K/M parasites isolated from footpad lesions of infected mice retained the increased NBD-PS accumulation phenotype.

Figure 7

(A) RT-PCR gene-expression analysis of wild-type and mutated LABCG2 in control and LABCG2K/M Leishmania parasites. The lower image shows the expression of GADPH used as internal loading control. RT-PCR was carried out for 35 cycles using RNA isolated from the above parasites and the products were run in 2% agarose gel. The positions of molecular markers (bp) are indicated on the left. (B) Accumulation of NBD-PS in control (grey histogram) and LABCG2K/M (uncoloured histogram) parasites. Parasites recovered from the footpad lesions of infected mice were maintained in culture medium and the stationary promastigotes incubated with the fluorescent phospholipid analogue NBD-PS for 30 min at 28°C. After washing and back-exchange with BSA, cell-associated fluorescence was measured by flow cytometry analysis as described in Materials and Methods. The dotted line represents non-labelled parasites.

Discussion

The exposure of PS on their cell surface is one of the mechanisms known to be used by Leishmania amastigotes and metacyclic promastigotes to infect host macrophages and to inhibit their microbicidal activity [7][9], [11], [14], [16]. PS is usually asymmetrically distributed in the cell membrane of eukaryotic cells and is present only in the cytoplasmic leaflet of the plasma membrane [18]. Although the PS synthesis in Leishmania have been a matter of intense debate [59], [60], in which the growth state of Leishmania parasites could be the possible discrepancy factor, it could be concluded that parasites in late logarithmic phase contain PS.

Although the molecular basis for this outward PS translocation in Leishmania remains unknown, herein we provide experimental evidence supporting the involvement of a new ABCG half-transporter (LABCG2) from Leishmania in this process.

Thus, down-regulation of LABCG2 function in L. major upon expression of an inactive version of the transporter (LABCG2K/M) diminishes the outward translocation of fluorescent short-chain analogues of PS (NBD-PS). This dominant-negative phenotype seems to be specific for the head of PL, as the movement of fluorescent analogues of PC, PE or SM was not affected. This substrate specificity contrasts with the broader spectrum of PL translocated by other lipid floppases [33], [36] and flippases [42] characterized in Leishmania. Similar results were obtained after expression of LABCG2K/M in L. donovani and L. infantum, thereby suggesting that the functionality of LABCG2 could be conserved in Leishmania spp. It should be noted, however, that this phenotype was not due to an LABCG2-mediated alteration of PL endocytosis as the internalization of NBD-SM (which is taken up by lipid-phase endocytosis) was not altered. In addition, Annexin V-Alexa 488 binding assays showed that LABCG2K/M promastigotes in the stationary phase exposed less endogenous PS than control parasites. As Annexin V is not entirely specific for PS, despite its widespread use in labelling it, and could bind to other anionic PL [60][62], we performed an additional control using papuamide B, a cytolytic peptide that specifically recognizes PS residues in biological membranes [54]. The reduced exposure of PS on the outer face of the plasma membrane in LABCG2K/M parasites was correlated with an increased resistance to papuamide B. Although these differences in resistance to papuamide B were not so higher, such differences were statistically significant and reproducible even in GFP-LABCG2K/M parasites, considering that extreme changes in the phospholipid asymmetry of the eukaryotic membranes lead to cell death [5], [22], [63]. The differences in Annexin V labelling between control and LABCG2K/M parasites were not observed during the log growth-phase of parasites, where the labelling was very low. This finding is in agreement with previous reports for L. donovani and L. tropica [14] and suggests that LABCG2-mediated PS exposure could be induced during metacyclogenesis of the parasite and is probably maintained in the intracellular amastigote stage. The constitutive expression of LABCG2 in both life-cycle stages of L. donovani has been described recently [34]. Although not discussed in detail in that study, LABCG2 expression seems to be higher in the amastigote forms than in the log-phase promastigote forms [34], as would be expected for a protein involved in PS externalization. In our case, the results have shown that the expression of LABCG2 increases in the early and late stationary phase compare with the log phase and this increase would be involved in the redistribution of PS to the outer leaflet of the plasma membrane in the metacyclic forms of the parasite. On the other hand, the localization of LABCG2 at both the flagellar pocket and the aflagellar pole as well as in intracellular vesicles, suggests a possible mechanism for PS exposure in Leishmania, similar to that described for human ABCG2, namely as an intracellular sterol transporter [64]. It remains possible that LABCG2 could transfer PS and other factors (as virulent factors) to the inner leaflet of these vesicles before their fusion with the plasma membrane at the flagellar pocket, followed by a redistribution of PS/other factors to the outer leaflet of the plasma membrane of the parasite (Fig. 8). In the case of LABCG2 K/M, the content of PS and other factors could be reduced in the intracellular vesicles and in the outer leaflet of plasma membrane, consequently influencing in the infectivity and virulence. A similar situation has been described for the LtrABCA2 transporter of Leishmania, involved in phospholipid trafficking and localized at the flagellar pocket and internal vesicles [43]. Additionally, LABCG2 could function as a floppase of PS/other factors due to their localization in the flagellar pocket of the parasite (Fig. 8).

Figure 8. Schematic diagram of the localization of LABCG2 in intracellular vesicles and flagellar pocket of Leishmania parasites.

Figure 8

It remains possible that LABCG2 could transfer PS and other factors (as virulent factors) to the inner leaflet of intracellular vesicles before their fusion with the plasma membrane at the flagellar pocket, followed by a redistribution of PS/other factors to the outer leaflet of the plasma membrane of the parasite.

In addition, the defect in PS externalization produced by down-regulation of LABCG2 function was found to be correlated with a significant reduction of the infection of mouse peritoneal macrophages by LABCG2K/M parasites. This finding agrees with previous reports [7], [14], which showed that PS exposure was important for macrophage engulfment of the promastigote and amastigote forms of Leishmania. As suggested [12], we believe that the only process probably affected would be the phagocytosis and consequently the variation of PS exposure could not be important for the interaction; this consideration would explain the observed differences in % of infected macrophages. Additionally, the reduced infectivity was not due to changes in the metacyclogenesis process considering that LABCG2 function does not affect either expression of the metacyclic marker protein HASPB or the number of metacyclic promastigotes produced.

Furthermore, the virulent factors LPG and gp63 are probably not affected by the function of LABCG2, as deduced by the absence of variations in the expression levels of these surface molecules, both of which have been suggested that play important roles in establishment of the infection. However, we cannot discard the possibility that other unknown factors involved in the virulence of Leishmania could be transported by LABCG2, and their expression could be affected in the LABCG2K/M parasites.

The decrease of the in vitro ability to infect macrophages observed in mutant parasites with a defect in PS exposure was found to be correlated with lower infectivity in an in vivo mouse model of cutaneous leishmaniasis, thereby supporting the proposal that LABCG2 function is required in order to develop the lesion. The role of the apoptosis-like PS exposure in the establishment of a Leishmania infection has been widely discussed. One possibility in this respect is that PS-positive cells do not necessarily die but use PS exposure, in an apoptosis-mimicking fashion, to infect macrophages and inhibit their microbicidal activity [8], [11], [16], [65]. The second possibility suggests that PS-positive forms are indeed “altruistic” apoptotic parasites that have been sentenced to death but are nevertheless required in order that the PS-negative infective parasites invade the host cell, in a truly cooperative system [16], [66]. Should be noted considered that these experiments were made using late stationary phase Leishmania parasites, where they begin to appreciate the apoptotic round shapes described above. In our case, the experiments were performed using early stationary phase Leishmania parasites, where rounded apoptotic forms were not detected. In any case, PS exposure is the relevant phenotype for macrophages infection and subsequent inactivation of microbicidal activity in both these scenarios, thereby allowing parasite persistence in the host [65].

The need for ABC half-transporters such as ABCG proteins to dimerize in order to reconstitute the ATP-binding sites and become functional has allowed us to test a dominant-negative approach to down-regulate LABCG2 function. Dominant-negative inhibition of mammalian ABCG2 [50], [67] and Leishmania LABCG5 [35] has also been described upon expression of different mutants of these transporters. Although the inhibition of homodimeric LABCG2 function is the most likely explanation for expression of the inactive version of LABCG2, we cannot rule out the inhibition of other putative partners. Indeed, some ABCG proteins, such as human ABCG5/8 [68] and Drosophila White, Brown and Scarlet, work as heterodimers [69]; the latter can even change the substrate transported as a function of the partner of the White protein. However, as expression of inactive versions of LABCG4 [32] and LABCG5 does not affect the translocation of PS [35] or the infectivity of the parasites, it is more likely that LABCG2 does not heterodimerize with these other Leishmania ABCG proteins; it could however dimerize with LABCG1, which is almost identical in its TMD.

A further attractive alternative could be that truncated LABCG3, which only includes the conserved Walker B, the signature motifs and two transmembrane segments and is expressed at least at mRNA levels [31], [34], could dimerize with LABCG2 to produce an inhibitory effect on LABCG2 function. This could be a novel way to regulate protein function in this parasite, although further experiments will be required to confirm this hypothesis.

Finally, LABCG2 belongs to the same subfamily as mammalian ABCG2, a well-characterized PS transporter [30] that also pumps drugs conferring a MDR phenotype in cancer cells [70], [71]. Others LABCG proteins, such as LABCG4 and LABCG6, also confer resistance to leishmanicidal agents [32], [33]. Future work in our group will examine the implication of LABCG2 in drug resistance.

In conclusion, we have provided evidence that strongly suggests the involvement of Leishmania LABCG2 function in the PS externalization required for the infection of host macrophages and development of the disease. Nonetheless, new approaches will be needed to fully understand the molecular mechanism by which LABCG2 affects the infectivity and virulence of Leishmania. Additionally, these findings indicate that LABCG2 could be considered as a promising drug target for leishmaniasis. Furthermore, as mutant parasites could be isolated from infected mice despite the absence of lesions, null mutants for LABCG2 could potentiality be used for live vaccination studies and to understand the role of LABCG2 in Leishmania pathogenesis.

Supporting Information

Figure S1

(A) Membrane topology model of the Leishmania half-transporters LABCG1, LABCG2 and LABCG3. The nucleotide binding domain (NBD) is located N-terminal with respect to the transmembrane domain (TMD). The putative membrane-spanning helices of the TMD are shown as cylinders passing through the lipid bilayer. The ATPase catalytic Walker A, Walker B, and the signature motif C localized in the nucleotide binding domain (NBD) are shown (boxes A, B and C, respectively). The arrow indicates the catalytic site mutation (K108M) engineered into the Walker A motif. The topology model was predicted using TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and TMRPres2D ((http://biophysics.biol.uoa.gr/TMRPres2D/) softwares. (B) Amino acid sequences and alignment (Clustal W) of L. major LABCG1, LABCG2 and LABCG3. Putative transmembrane segments predicted by TMHMM and TMRPres2D are underlined. The Walker A/Walker B motifs, and the ABC family signature motif C are boxed. Identical amino acids present in the three sequences are indicated by *, the amino acid similarity is indicated by : and weak similar amino acid are indicated by . . Gaps introduced for the sequence alignment are indicated by -.

(TIF)

Figure S2

Gene-expression analysis of LABCG2 in Leishmania lines. (A) Upper panel: gene expression of LABCG2 by RT-PCR as indicated by the amplified 280 bp LABCG2 fragment. Lower panel: gene expression of GADPH as internal loading control. The arrow indicates amplified 227 bp GADPH fragment. Lane 1: DNA marker phi 174 HaeIII; lane 2: control parasites; lane 3: LABCG2K/M parasites. RT-PCR was carried out for 35 cycles using RNA isolated from the above-mentioned parasites and the products run in 2% agarose gel. (B) Growth curve of control (black circles) and LABCG2K/M (black squares) parasites at different time points (24, 48, 72, 96 and 120 h). The results represent the means ± SD of three independent experiments.

(TIF)

Figure S3

Protein expression in GFP-LABCG2 and GFP-LABCG2K/M Leishmania parasites. Immunodetection of GFP (A) or H2A histone (lower inset) in L. major lines expressing control GFP (lane 1), GFP-LABCG2 (lane 2) and GFP-LABCG2K/M (lane 3). Western blot analysis of total proteins from parasites incubated with antibodies against GFP or H2A histone, as loading control, at a 1∶5000 dilution. The molecular mass standards (kDa) from Bio-Rad are indicated on the left. (B) L. major stationary promastigotes transfected with pXG-GFP+ and LABCG2K/M-GFP were fixed for 10 min in 2% paraformaldehyde at 4°C. a and c, Nomarski images of b and d, respectively. b shows the cytoplasmic localization of the protein GFP and d corresponds to localization sites of LABCG2K/M-GFP, indicated by white arrows in the merged images. Scale bar: 5 µm. FP: flagellar pocket; AP: aflagellar pole. The figure illustrates a representative parasite of a total population of parasites with a similar fluorescence pattern.

(TIF)

Figure S4

Fluorescent PS accumulation in Leishmania parasites. Stationary promastigotes of L. infantum (A) or L. donovani (B) were incubated with the fluorescent PL analogue NBD-PS for 30 min at 28°C. After washing and back-exchange with BSA, cell-associated fluorescence was measured by flow cytometry analysis. The grey histogram represents control parasites transfected with the empty vector, the uncoloured histogram represents parasites expressing LABCG2K/M and the dotted histogram represents non-labelled cells. The histograms correspond to a representative experiment from three independent experiments.

(TIF)

Figure S5

The externalization of endogenous PS in Leishmania parasites. PS exposure at the outer leaflet of the parasite plasma membrane was analyzed by flow cytometry using Annexin V–Alexa 488 in control parasites as described in Materials and Methods. Controls measurements in the absence of calcium were included using Annexin V–Alexa 488 plus 8 mM EGTA. The results shown are representative of three independent duplicated experiments ± SD. * P<0.05 vs. control parasites.

(TIF)

Figure S6

LABCG2K/M parasites has not affected its capacity of binding to macrophages. (A) Binding of control and LABCG2K/M metacyclic promastigotes to mouse peritoneal macrophages. Percentage of positive interaction of promastigotes to macrophages after 4 h interaction was determined by a fluorescence microscopy analysis counting 100 macrophages/well. The results represent the means ± SD of three independent experiments. (B) Micrograph of double-fluorescence labeling of the binding of Leishmania control and LABCG2K/M metacyclic parasites to mouse peritoneal macrophages. Cell Tracker TM Green-labeled parasites were added (5∶1) to mouse peritoneal macrophages relabeled with FM4-64 (red). a and c, Nomarski images of b and d, respectively. b and d shows the binding and intracellular localization of control and LABCG2K/M parasites. Scale bar: 10 µm. The expression levels of two surface molecules, LPG (C) and gp63 (D), were determined in control and LABCG2K/M parasites marked with fluorescein-conjugated ricin agglutinin that specifically labels LPG (C) and a specific monoclonal antibody for Leishmania gp63 (D). The fluorescence intensity was determined by flow cytometry analysis, as described in Materials and Methods. The data are means of the geometrical mean channel fluorescence values (g.m.) ± SD of three independent experiments versus controls.

(TIF)

Figure S7

LABCG2K/M Leishmania parasites do not show defective metacyclogenesis. (A) Control and LABCG2K/M metacyclic parasites were purified from stationary promastigotes using negative selection with the lectin PNA, as described in Materials and Methods. The results represent the means ± SD of four independent experiments. (B) Analysis by flow cytometry of the FSC-H of control and LABCG2K/M metacyclic parasites; right panel shows a Nomarsky micrography of the same samples. Scale bar: 5 µm. (C) Total cell lysates from stationary promastigotes were analyzed by Western blotting with an antibody to the metacyclic protein HASPB. Anti-alpha tubulin antibody was used as loading control. The positions of molecular marker (kDa) are indicated on the left.

(TIF)

Figure S8

LABCG2K/M parasites are less infective in a mouse model of cutaneous leishmaniasis. A second independent transfection event using control and LABCG2K/M parasites was inoculated in mice, as described in Materials and Methods. The inflammation (A), lesion size (B) and parasite burden in footpad (D) and tissues (E) such as lymph nodes (LN) and spleen (SP) were determined weekly. The pictures in C show the lesion at week 5 post-infection. The results represent the means ± SD of three independent experiments, with 10 mice per group. Mice were euthanized when the lesion size in controls reached a value of 50–70 mm2. *P<0.05 vs. control parasites; n.d. stands for not detected.

(TIF)

Acknowledgments

We thank Stephen M. Beverley (Washington University, School of Medicine, USA) for providing the vectors pXG-GFP+2′ and pXG-'GFP+, Barbara A. Smith (University of York, UK) for providing the polyclonal antisera against metacyclic marker protein HASPB, and Thomas Gunther Pomorski and Rosa López (Department of Plan Biology and Biotechnology, University of Copenhagen, Denmark), for providing the papuamide B peptide.

Funding Statement

This work was supported by the Spanish Grants SAF2009-07440 and SAF2012-34267 (to F.G.), SAF2011-28215 (to J.M.P.V.) and SAF2011-28102 (to S.C.), the EU Marie Curie Research Training Network Grant MRTN-CT-2004-005330 (to F.G.), the Plan Andaluz de Investigación (Cod. BIO130) and by FEDER funds from the EU to F.G., S.C. and J.M.P.V. and funds from Junta de Andalucia (Spain) P09-CTS-4705 (E. G-R). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Santos DO, Coutinho CE, Madeira MF, Bottino CG, Vieira RT, et al. (2008) Leishmaniasis treatment-a challenge that remains: a review. Parasitol Res 3: 1–10. [DOI] [PubMed] [Google Scholar]
  • 2. Peters NC, Egen JG, Secundino N, Debrabant A, Kimblin N, et al. (2008) In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science 321: 970–974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Melby PC (2002) Vaccination against cutaneous leishmaniasis: current status. Am J Clin Dermatol 3: 557–570. [DOI] [PubMed] [Google Scholar]
  • 4. Kaye P, Scott P (2011) Leishmaniasis: complexity at the host-pathogen interface. Nat Rev Microbiol 9: 604–615. [DOI] [PubMed] [Google Scholar]
  • 5. Pomorski T, Menon AK (2006) Lipid flippases and their biological functions. Cell Mol Life Sci 63: 2908–2921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ritter U, Frischknecht F, van Zandbergen G (2009) Are neutrophils important host cells for Leishmania parasites? Trends Parasitol 25: 505–510. [DOI] [PubMed] [Google Scholar]
  • 7. Wanderley JL, Moreira ME, Benjamin A, Bonomo AC, Barcinski MA (2006) Mimicry of apoptotic cells by exposing phosphatidylserine participates in the establishment of amastigotes of Leishmania (L) amazonensis in mammalian hosts. J Immunol 176: 1834–1839. [DOI] [PubMed] [Google Scholar]
  • 8. de Freitas Balanco JM, Moreira ME, Bonomo A, Bozza PT, Amarante-Mendes G, et al. (2001) Apoptotic mimicry by an obligate intracellular parasite downregulates macrophage microbicidal activity. Curr Biol 11: 1870–1873. [DOI] [PubMed] [Google Scholar]
  • 9. Wanderley JL, Benjamin A, Real F, Bonomo A, Moreira ME, et al. (2005) Apoptotic mimicry: an altruistic behavior in host/Leishmania interplay. Braz J Med Biol Res 38: 807–812. [DOI] [PubMed] [Google Scholar]
  • 10. Schlegel RA, Williamson P (2001) Phosphatidylserine, a death knell. Cell Death Differ 8: 551–563. [DOI] [PubMed] [Google Scholar]
  • 11. van Zandbergen G, Solbach W, Laskay T (2007) Apoptosis driven infection. Autoimmunity 40: 349–352. [DOI] [PubMed] [Google Scholar]
  • 12. Wanderley JL, Pinto da Silva LH, Deolindo P, Soong L, Borges VM, et al. (2009) Cooperation between apoptotic and viable metacyclics enhances the pathogenesis of Leishmaniasis. PLoS One 4: e5733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Luder CG, Campos-Salinas J, Gonzalez-Rey E, van Zandbergen G (2010) Impact of protozoan cell death on parasite-host interactions and pathogenesis. Parasit Vectors 3: 116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Tripathi A, Gupta CM (2003) Transbilayer translocation of membrane phosphatidylserine and its role in macrophage invasion in Leishmania promastigotes. Mol Biochem Parasitol 128: 1–9. [DOI] [PubMed] [Google Scholar]
  • 15. Russell DG, Wilhelm H (1986) The involvement of the major surface glycoprotein (gp63) of Leishmania promastigotes in attachment to macrophages. J Immunol 136: 2613–2620. [PubMed] [Google Scholar]
  • 16. van Zandbergen G, Bollinger A, Wenzel A, Kamhawi S, Voll R, et al. (2006) Leishmania disease development depends on the presence of apoptotic promastigotes in the virulent inoculum. Proc Natl Acad Sci U S A 103: 13837–13842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Franca-Costa J, Wanderley JL, Deolindo P, Zarattini JB, Costa J, et al. (2012) Exposure of Phosphatidylserine on Leishmania amazonensis Isolates Is Associated with Diffuse Cutaneous Leishmaniasis and Parasite Infectivity. PLoS One 7: e36595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. van Meer G, Voelker DR, Feigenson GW (2008) Membrane lipids: where they are and how they behave. Nat Rev Mol Cell Biol 9: 112–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Bratton DL, Fadok VA, Richter DA, Kailey JM, Guthrie LA, et al. (1997) Appearance of phosphatidylserine on apoptotic cells requires calcium-mediated nonspecific flip-flop and is enhanced by loss of the aminophospholipid translocase. J Biol Chem 272: 26159–26165. [DOI] [PubMed] [Google Scholar]
  • 20. Marguet D, Luciani MF, Moynault A, Williamson P, Chimini G (1999) Engulfment of apoptotic cells involves the redistribution of membrane phosphatidylserine on phagocyte and prey. Nat Cell Biol 1: 454–456. [DOI] [PubMed] [Google Scholar]
  • 21. Mirnikjoo B, Balasubramanian K, Schroit AJ (2009) Suicidal membrane repair regulates phosphatidylserine externalization during apoptosis. J Biol Chem 284: 22512–22516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Weingartner A, Drobot B, Herrmann A, Sanchez-Canete MP, Gamarro F, et al. (2010) Disruption of the lipid-transporting LdMT-LdRos3 complex in Leishmania donovani affects membrane lipid asymmetry but not host cell invasion. PLoS One 5: e12443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Seifert K, Perez-Victoria FJ, Stettler M, Sanchez-Canete MP, Castanys S, et al. (2007) Inactivation of the miltefosine transporter, LdMT, causes miltefosine resistance that is conferred to the amastigote stage of Leishmania donovani and persists in vivo. Int J Antimicrob Agents 30: 229–235. [DOI] [PubMed] [Google Scholar]
  • 24. Weingartner A, dos Santos MG, Drobot B, Pomorski TG (2011) Ca2+-activated transbilayer movement of plasma membrane phospholipids in Leishmania donovani during ionomycin or thapsigargin stimulation. Mol Biochem Parasitol 179: 59–68. [DOI] [PubMed] [Google Scholar]
  • 25. Higgins CF (2001) ABC transporters: physiology, structure and mechanism–an overview. Res Microbiol 152: 205–210. [DOI] [PubMed] [Google Scholar]
  • 26. Locher KP (2009) Review. Structure and mechanism of ATP-binding cassette transporters. Philos Trans R Soc Lond B Biol Sci 364: 239–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Nagao K, Kimura Y, Mastuo M, Ueda K (2010) Lipid outward translocation by ABC proteins. FEBS Lett 584: 2717–2723. [DOI] [PubMed] [Google Scholar]
  • 28. Woodward OM, Kottgen A, Kottgen M (2011) ABCG transporters and disease. FEBS J 278: 3215–3225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Goler-Baron V, Assaraf YG (2011) Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance. PLoS One 6: e16007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Woehlecke H, Pohl A, Alder-Baerens N, Lage H, Herrmann A (2003) Enhanced exposure of phosphatidylserine in human gastric carcinoma cells overexpressing the half-size ABC transporter BCRP (ABCG2). Biochem J 376: 489–495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Leprohon P, Legare D, Girard I, Papadopoulou B, Ouellette M (2006) Modulation of Leishmania ABC protein gene expression through life stages and among drug-resistant parasites. Eukaryot Cell 5: 1713–1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Castanys-Munoz E, Alder-Baerens N, Pomorski T, Gamarro F, Castanys S (2007) A novel ATP-binding cassette transporter from Leishmania is involved in transport of phosphatidylcholine analogues and resistance to alkyl-phospholipids. Mol Microbiol 64: 1141–1153. [DOI] [PubMed] [Google Scholar]
  • 33. Castanys-Munoz E, Perez-Victoria JM, Gamarro F, Castanys S (2008) Characterization of an ABCG-like transporter from the protozoan parasite Leishmania with a role in drug resistance and transbilayer lipid movement. Antimicrob Agents Chemother 52: 3573–3579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Bosedasgupta S, Ganguly A, Roy A, Mukherjee T, Majumder HK (2008) A novel ATP-binding cassette transporter, ABCG6 is involved in chemoresistance of Leishmania. Mol Biochem Parasitol 158: 176–188. [DOI] [PubMed] [Google Scholar]
  • 35. Campos-Salinas J, Cabello-Donayre M, Garcia-Hernandez R, Perez-Victoria I, Castanys S, et al. (2011) A new ATP-binding cassette protein is involved in intracellular haem trafficking in Leishmania. Mol Microbiol 79: 1430–1444. [DOI] [PubMed] [Google Scholar]
  • 36. Perez-Victoria JM, Perez-Victoria FJ, Parodi-Talice A, Jimenez IA, Ravelo AG, et al. (2001) Alkyl-lysophospholipid resistance in multidrug-resistant Leishmania tropica and chemosensitization by a novel P-glycoprotein-like transporter modulator. Antimicrob Agents Chemother 45: 2468–2474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Parodi-Talice A, Araujo JM, Torres C, Perez-Victoria JM, Gamarro F, et al. (2003) The overexpression of a new ABC transporter in Leishmania is related to phospholipid trafficking and reduced infectivity. Biochim Biophys Acta 1612: 195–207. [DOI] [PubMed] [Google Scholar]
  • 38. Araujo-Santos JM, Parodi-Talice A, Castanys S, Gamarro F (2005) The overexpression of an intracellular ABCA-like transporter alters phospholipid trafficking in Leishmania. Biochem Biophys Res Commun 330: 349–355. [DOI] [PubMed] [Google Scholar]
  • 39. Kennedy ML, Cortes-Selva F, Perez-Victoria JM, Jimenez IA, Gonzalez AG, et al. (2001) Chemosensitization of a multidrug-resistant Leishmania tropica line by new sesquiterpenes from Maytenus magellanica and Maytenus chubutensis. J Med Chem 44: 4668–4676. [DOI] [PubMed] [Google Scholar]
  • 40. Lario A, Gonzalez A, Dorado G (1997) Automated laser-induced fluorescence DNA sequencing: equalizing signal-to-noise ratios significantly enhances overall performance. Anal Biochem 247: 30–33. [DOI] [PubMed] [Google Scholar]
  • 41. Ha DS, Schwarz JK, Turco SJ, Beverley SM (1996) Use of the green fluorescent protein as a marker in transfected Leishmania. Mol Biochem Parasitol 77: 57–64. [DOI] [PubMed] [Google Scholar]
  • 42. Perez-Victoria FJ, Gamarro F, Ouellette M, Castanys S (2003) Functional cloning of the miltefosine transporter. A novel P-type phospholipid translocase from Leishmania involved in drug resistance. J Biol Chem 278: 49965–49971. [DOI] [PubMed] [Google Scholar]
  • 43. Araujo-Santos JM, Gamarro F, Castanys S, Herrmann A, Pomorski T (2003) Rapid transport of phospholipids across the plasma membrane of Leishmania infantum. Biochem Biophys Res Commun 306: 250–255. [DOI] [PubMed] [Google Scholar]
  • 44. Cavazzuti A, Paglietti G, Hunter WN, Gamarro F, Piras S, et al. (2008) Discovery of potent pteridine reductase inhibitors to guide antiparasite drug development. Proc Natl Acad Sci U S A 105: 1448–1453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Spath GF, Epstein L, Leader B, Singer SM, Avila HA, et al. (2000) Lipophosphoglycan is a virulence factor distinct from related glycoconjugates in the protozoan parasite Leishmania major. Proc Natl Acad Sci U S A 97: 9258–9263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Sacks DL, Hieny S, Sher A (1985) Identification of cell surface carbohydrate and antigenic changes between noninfective and infective developmental stages of Leishmania major promastigotes. J Immunol 135: 564–569. [PubMed] [Google Scholar]
  • 47. Chiquero MJ, Perez-Victoria JM, O'Valle F, Gonzalez-Ros JM, del Moral RG, et al. (1998) Altered drug membrane permeability in a multidrug-resistant Leishmania tropica line. Biochem Pharmacol 55: 131–139. [DOI] [PubMed] [Google Scholar]
  • 48. von Stebut E, Belkaid Y, Nguyen BV, Cushing M, Sacks DL, et al. (2000) Leishmania major-infected murine langerhans cell-like dendritic cells from susceptible mice release IL-12 after infection and vaccinate against experimental cutaneous Leishmaniasis. Eur J Immunol 30: 3498–3506. [DOI] [PubMed] [Google Scholar]
  • 49. Ozvegy C, Varadi A, Sarkadi B (2002) Characterization of drug transport, ATP hydrolysis, and nucleotide trapping by the human ABCG2 multidrug transporter. Modulation of substrate specificity by a point mutation. J Biol Chem 277: 47980–47990. [DOI] [PubMed] [Google Scholar]
  • 50. Henriksen U, Gether U, Litman T (2005) Effect of Walker A mutation (K86M) on oligomerization and surface targeting of the multidrug resistance transporter ABCG2. J Cell Sci 118: 1417–1426. [DOI] [PubMed] [Google Scholar]
  • 51. Besteiro S, Williams RA, Morrison LS, Coombs GH, Mottram JC (2006) Endosome sorting and autophagy are essential for differentiation and virulence of Leishmania major. J Biol Chem 281: 11384–11396. [DOI] [PubMed] [Google Scholar]
  • 52. Denny PW, Lewis S, Tempero JE, Goulding D, Ivens AC, et al. (2002) Leishmania RAB7: characterisation of terminal endocytic stages in an intracellular parasite. Mol Biochem Parasitol 123: 105–113. [DOI] [PubMed] [Google Scholar]
  • 53. Tarling EJ, Edwards PA (2012) Dancing with the sterols: critical roles for ABCG1, ABCA1, miRNAs, and nuclear and cell surface receptors in controlling cellular sterol homeostasis. Biochim Biophys Acta 1821: 386–395. [DOI] [PubMed] [Google Scholar]
  • 54. Parsons AB, Lopez A, Givoni IE, Williams DE, Gray CA, et al. (2006) Exploring the mode-of-action of bioactive compounds by chemical-genetic profiling in yeast. Cell 126: 611–625. [DOI] [PubMed] [Google Scholar]
  • 55. Kato U, Emoto K, Fredriksson C, Nakamura H, Ohta A, et al. (2002) A novel membrane protein, Ros3p, is required for phospholipid translocation across the plasma membrane in Saccharomyces cerevisiae. J Biol Chem 277: 37855–37862. [DOI] [PubMed] [Google Scholar]
  • 56. Moitra K, Silverton L, Limpert K, Im K, Dean M (2011) Moving out: from sterol transport to drug resistance - the ABCG subfamily of efflux pumps. Drug Metabol Drug Interact 26: 105–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Spath GF, Beverley SM (2001) A lipophosphoglycan-independent method for isolation of infective Leishmania metacyclic promastigotes by density gradient centrifugation. Exp Parasitol 99: 97–103. [DOI] [PubMed] [Google Scholar]
  • 58. Sadlova J, Price HP, Smith BA, Votypka J, Volf P, et al. (2010) The stage-regulated HASPB and SHERP proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand fly vector, Phlebotomus papatasi. Cell Microbiol 12: 1765–1779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Imbert L, Ramos RG, Libong D, Abreu S, Loiseau PM, et al. (2012) Identification of phospholipid species affected by miltefosine action in Leishmania donovani cultures using LC-ELSD, LC-ESI/MS, and multivariate data analysis. Anal Bioanal Chem 402: 1169–1182. [DOI] [PubMed] [Google Scholar]
  • 60. Weingartner A, Kemmer G, Muller FD, Zampieri RA, Gonzaga dos Santos M, et al. (2012) Leishmania promastigotes lack phosphatidylserine but bind annexin V upon permeabilization or miltefosine treatment. PLoS One 7: e42070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Yeung T, Heit B, Dubuisson JF, Fairn GD, Chiu B, et al. (2009) Contribution of phosphatidylserine to membrane surface charge and protein targeting during phagosome maturation. J Cell Biol 185: 917–928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Zhang K, Beverley SM (2010) Phospholipid and sphingolipid metabolism in Leishmania. Mol Biochem Parasitol 170: 55–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Graham TR (2004) Flippases and vesicle-mediated protein transport. Trends Cell Biol 14: 670–677. [DOI] [PubMed] [Google Scholar]
  • 64. Tarling EJ, Edwards PA (2011) ATP binding cassette transporter G1 (ABCG1) is an intracellular sterol transporter. Proc Natl Acad Sci U S A 108: 19719–19724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Barcinski MA, Moreira ME, Balanco JM, Wanderley JL, Bonomo AC (2003) The role of apoptotic mimicry in host-parasite interplay: is death the only alternative for altruistic behavior? Kinetoplastid Biol Dis 2: 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Laskay T, van Zandbergen G, Solbach W (2003) Neutrophil granulocytes–Trojan horses for Leishmania major and other intracellular microbes? Trends Microbiol 11: 210–214. [DOI] [PubMed] [Google Scholar]
  • 67. Kage K, Tsukahara S, Sugiyama T, Asada S, Ishikawa E, et al. (2002) Dominant-negative inhibition of breast cancer resistance protein as drug efflux pump through the inhibition of S-S dependent homodimerization. Int J Cancer 97: 626–630. [DOI] [PubMed] [Google Scholar]
  • 68. Wang J, Zhang DW, Lei Y, Xu F, Cohen JC, et al. (2008) Purification and reconstitution of sterol transfer by native mouse ABCG5 and ABCG8. Biochemistry 47: 5194–5204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Schmitz G, Langmann T, Heimerl S (2001) Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res 42: 1513–1520. [PubMed] [Google Scholar]
  • 70. Polgar O, Robey RW, Bates SE (2008) ABCG2: structure, function and role in drug response. Expert Opin Drug Metab Toxicol 4: 1–15. [DOI] [PubMed] [Google Scholar]
  • 71. Leslie EM, Deeley RG, Cole SP (2005) Multidrug resistance proteins: role of P-glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol Appl Pharmacol 204: 216–237. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

(A) Membrane topology model of the Leishmania half-transporters LABCG1, LABCG2 and LABCG3. The nucleotide binding domain (NBD) is located N-terminal with respect to the transmembrane domain (TMD). The putative membrane-spanning helices of the TMD are shown as cylinders passing through the lipid bilayer. The ATPase catalytic Walker A, Walker B, and the signature motif C localized in the nucleotide binding domain (NBD) are shown (boxes A, B and C, respectively). The arrow indicates the catalytic site mutation (K108M) engineered into the Walker A motif. The topology model was predicted using TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and TMRPres2D ((http://biophysics.biol.uoa.gr/TMRPres2D/) softwares. (B) Amino acid sequences and alignment (Clustal W) of L. major LABCG1, LABCG2 and LABCG3. Putative transmembrane segments predicted by TMHMM and TMRPres2D are underlined. The Walker A/Walker B motifs, and the ABC family signature motif C are boxed. Identical amino acids present in the three sequences are indicated by *, the amino acid similarity is indicated by : and weak similar amino acid are indicated by . . Gaps introduced for the sequence alignment are indicated by -.

(TIF)

Figure S2

Gene-expression analysis of LABCG2 in Leishmania lines. (A) Upper panel: gene expression of LABCG2 by RT-PCR as indicated by the amplified 280 bp LABCG2 fragment. Lower panel: gene expression of GADPH as internal loading control. The arrow indicates amplified 227 bp GADPH fragment. Lane 1: DNA marker phi 174 HaeIII; lane 2: control parasites; lane 3: LABCG2K/M parasites. RT-PCR was carried out for 35 cycles using RNA isolated from the above-mentioned parasites and the products run in 2% agarose gel. (B) Growth curve of control (black circles) and LABCG2K/M (black squares) parasites at different time points (24, 48, 72, 96 and 120 h). The results represent the means ± SD of three independent experiments.

(TIF)

Figure S3

Protein expression in GFP-LABCG2 and GFP-LABCG2K/M Leishmania parasites. Immunodetection of GFP (A) or H2A histone (lower inset) in L. major lines expressing control GFP (lane 1), GFP-LABCG2 (lane 2) and GFP-LABCG2K/M (lane 3). Western blot analysis of total proteins from parasites incubated with antibodies against GFP or H2A histone, as loading control, at a 1∶5000 dilution. The molecular mass standards (kDa) from Bio-Rad are indicated on the left. (B) L. major stationary promastigotes transfected with pXG-GFP+ and LABCG2K/M-GFP were fixed for 10 min in 2% paraformaldehyde at 4°C. a and c, Nomarski images of b and d, respectively. b shows the cytoplasmic localization of the protein GFP and d corresponds to localization sites of LABCG2K/M-GFP, indicated by white arrows in the merged images. Scale bar: 5 µm. FP: flagellar pocket; AP: aflagellar pole. The figure illustrates a representative parasite of a total population of parasites with a similar fluorescence pattern.

(TIF)

Figure S4

Fluorescent PS accumulation in Leishmania parasites. Stationary promastigotes of L. infantum (A) or L. donovani (B) were incubated with the fluorescent PL analogue NBD-PS for 30 min at 28°C. After washing and back-exchange with BSA, cell-associated fluorescence was measured by flow cytometry analysis. The grey histogram represents control parasites transfected with the empty vector, the uncoloured histogram represents parasites expressing LABCG2K/M and the dotted histogram represents non-labelled cells. The histograms correspond to a representative experiment from three independent experiments.

(TIF)

Figure S5

The externalization of endogenous PS in Leishmania parasites. PS exposure at the outer leaflet of the parasite plasma membrane was analyzed by flow cytometry using Annexin V–Alexa 488 in control parasites as described in Materials and Methods. Controls measurements in the absence of calcium were included using Annexin V–Alexa 488 plus 8 mM EGTA. The results shown are representative of three independent duplicated experiments ± SD. * P<0.05 vs. control parasites.

(TIF)

Figure S6

LABCG2K/M parasites has not affected its capacity of binding to macrophages. (A) Binding of control and LABCG2K/M metacyclic promastigotes to mouse peritoneal macrophages. Percentage of positive interaction of promastigotes to macrophages after 4 h interaction was determined by a fluorescence microscopy analysis counting 100 macrophages/well. The results represent the means ± SD of three independent experiments. (B) Micrograph of double-fluorescence labeling of the binding of Leishmania control and LABCG2K/M metacyclic parasites to mouse peritoneal macrophages. Cell Tracker TM Green-labeled parasites were added (5∶1) to mouse peritoneal macrophages relabeled with FM4-64 (red). a and c, Nomarski images of b and d, respectively. b and d shows the binding and intracellular localization of control and LABCG2K/M parasites. Scale bar: 10 µm. The expression levels of two surface molecules, LPG (C) and gp63 (D), were determined in control and LABCG2K/M parasites marked with fluorescein-conjugated ricin agglutinin that specifically labels LPG (C) and a specific monoclonal antibody for Leishmania gp63 (D). The fluorescence intensity was determined by flow cytometry analysis, as described in Materials and Methods. The data are means of the geometrical mean channel fluorescence values (g.m.) ± SD of three independent experiments versus controls.

(TIF)

Figure S7

LABCG2K/M Leishmania parasites do not show defective metacyclogenesis. (A) Control and LABCG2K/M metacyclic parasites were purified from stationary promastigotes using negative selection with the lectin PNA, as described in Materials and Methods. The results represent the means ± SD of four independent experiments. (B) Analysis by flow cytometry of the FSC-H of control and LABCG2K/M metacyclic parasites; right panel shows a Nomarsky micrography of the same samples. Scale bar: 5 µm. (C) Total cell lysates from stationary promastigotes were analyzed by Western blotting with an antibody to the metacyclic protein HASPB. Anti-alpha tubulin antibody was used as loading control. The positions of molecular marker (kDa) are indicated on the left.

(TIF)

Figure S8

LABCG2K/M parasites are less infective in a mouse model of cutaneous leishmaniasis. A second independent transfection event using control and LABCG2K/M parasites was inoculated in mice, as described in Materials and Methods. The inflammation (A), lesion size (B) and parasite burden in footpad (D) and tissues (E) such as lymph nodes (LN) and spleen (SP) were determined weekly. The pictures in C show the lesion at week 5 post-infection. The results represent the means ± SD of three independent experiments, with 10 mice per group. Mice were euthanized when the lesion size in controls reached a value of 50–70 mm2. *P<0.05 vs. control parasites; n.d. stands for not detected.

(TIF)


Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES