Skip to main content
. 2004 Feb 3;4:6. doi: 10.1186/1471-2180-4-6

Table 2.

Sets of primers used for site-directed mutagenesis in this study

Mutation Primer setsa
D10K 5' tgcgggcattaagctgggaggaacgacgat 3'
5' aaccatatctcgtccatggatccgtgatgg 3'
C166A 5' ggccatattgccagcatccctgaaggcgga 3'
5' gatttctccgccggcgccatttataccatg 3'
C175A 5' gcgcccgccaactgcggcaaaacgggctgt 3'
5' tccgccttcagggatgctgcaaatatggcc 3'
C177A 5' tgcaacgccggcaaaacgggctgtatcgaa 3'
5' gggcgctccgccttcagggatgctgcaaat 3'
C182A 5' ggcaaaacgggcgctatcgaaacaattgcg 3'
5' gcagttgcagggcgctccgccttcagggat 3'
C282A 5' cgcaaagccgcgtttccgcgggcagcccaa 3'
5' gaatgttttctcgacttttgatctcagcag 3'
C321A 5' catcaaaatgcttaaaattgtgtaaatgaa 3'
5' tttcagccattcatttttagcgatccaagc 3'

a Underlined is mutated nucleotide.