Skip to main content
. 2013 Mar 28;29(10):1268–1274. doi: 10.1093/bioinformatics/btt149

Table 1.

Example of distances obtained with the DBC454 metric (see Section 3.1.1) compared with the percent of divergence [100 − percent identity (%ID)], when aligning the wild-type sequence with a sequence in which the GGC (underlined) was replaced with various short sequences

Substitution for GGC DBC454 distance 100 %ID
AGC Inline graphic 0.820
TGC Inline graphic 0.820
CGC Inline graphic 0.820
GGCA Inline graphic 0.810
GGCT Inline graphic 0.810
GGCC Inline graphic 0.810
GGGC Inline graphic 0.810
ATCG Inline graphic 2.440
ATCGATCG Inline graphic 5.510
ATCGATCGATCG Inline graphic 8.400

wild-type: AACGAATGGGTCTTCGGGCCCTTCCAACCCTCAAAACCTGTGGAAGCAAAAGATGTGTTTCGGCGCCGCCGCGCGCCGCATTTATGCAGCGTTATGCTTGTTGTCTGGATTGCAAAGAAATT.