Table 1.
Example of distances obtained with the DBC454 metric (see Section 3.1.1) compared with the percent of divergence [100 − percent identity (%ID)], when aligning the wild-type sequence with a sequence in which the GGC (underlined) was replaced with various short sequences
Substitution for GGC | DBC454 distance | 100 %ID |
---|---|---|
AGC | ![]() |
0.820 |
TGC | ![]() |
0.820 |
CGC | ![]() |
0.820 |
GGCA | ![]() |
0.810 |
GGCT | ![]() |
0.810 |
GGCC | ![]() |
0.810 |
GGGC | ![]() |
0.810 |
ATCG | ![]() |
2.440 |
ATCGATCG | ![]() |
5.510 |
ATCGATCGATCG | ![]() |
8.400 |
wild-type: AACGAATGGGTCTTCGGGCCCTTCCAACCCTCAAAACCTGTGGAAGCAAAAGATGTGTTTCGGCGCCGCCGCGCGCCGCATTTATGCAGCGTTATGCTTGTTGTCTGGATTGCAAAGAAATT.