Table 1.

Oligonucleotides used

Name	Sequence 5′-3′	Use
LS-005	TTTTTTCATATGTCCATCACCGCCAGCGAAG	Forward oligonucleotide to amplify yefMsl. The sequence recognized by NdeI is underlined.
LS-022	TTTTTTCTCGAGCGCCCGCTCCGCGTCCGGG	Reverse oligonucleotide to amplify yefMsl. The sequence recognized by XhoI is underlined.
MRG-11	TTTTTTCATATGGCCCGCAGACTCCGCACC	Forward oligonucleotide to amplify the amylase gene (amy) from S. griseus. The sequence recognized by NdeI is underlined.
MRG-12	TTTTTTCTCGAGGCCGCGCCAGGTGTCGTTGAG	Reverse oligonucleotide to amplify the amylase gene (amy) from S. griseus. The sequence recognized by XhoI is underlined.