Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Details of the TaqMan real-time PCR assays.
| Gene | Oligo | Sequence (5′→ 3′) | Amplicon size (bp) | Final conc. (nM) |
|---|---|---|---|---|
| GAPDH1 | Forward | GCCATCAATGACCCCTTCAT | 82 | 480 |
| Reverse | GCCGTGGAATTTGCCGT | 480 | ||
| Probe | CTCAACTACATGGTCTACATGTTCCAGTATGATTCCA2 | 160 | ||
|
| ||||
| ALB3 | Forward | GATGGCTGATTGCTGTGAGA | 150 | 500 |
| Reverse | CCCAGGAACCTCTGTTCATT | 500 | ||
| Probe | ATCCCGGCTTCGGTCAGCTG2,4 | 200 | ||
1[10]; 25′FAM/3′TAMRA; 3present study; 4HPLC purification.
