Table 2.
STS primer sets discriminating ginseng cultivars
| gDNA library | STS primer | |||||
|---|---|---|---|---|---|---|
|
| ||||||
| Clone information1) | Primer name | Primer sequence2) | PCR information3) | |||
|
|
|
|||||
| ID | Insert size (bp) | Gene bank no. | Forward (5’→3’) Reverse (5’→3’) | PCR product size (bp) | Anneal temp (℃) | |
|
| ||||||
| UFG0074 | 717 | HN339415 | UFGp74 | GCGAATTTCACAGAATTAGACG | 639 | 65 |
| ACAGGTCTCGAAACAATTGAAG | ||||||
| MFG0110 | 1129 | HN339416 | MFGp110A | AGTCCCAACGGAATTTCATC | 930 | 65 |
| GTTTTCCGCTTATGTTGCAG | ||||||
| MFG0130 | 1124 | HN339417 | MFGp130A | GGAAAGCGTTCAGCTCTTACG | 322 | 65 |
| TAAATGCTGTCAAGCCCAGAG | ||||||
1) gDNA library clones of Panax ginseng cv. Yunpoong.
2) Primers were converted from gDNA library clones of P. ginseng cv. Yunpoong and sequence-tagged site (STS) primers were designed by Lee [23].
3) The polymerase chain reaction (PCR) product size by using the recommended annealing temperature (anneal temp) and the genomic DNA of P. ginseng cv. Yunpoong.