Table 1.
MIRNA | Enriched sequencea | Abundance (TP10M)b | Positionc | Size (nt) | Repeat class/familyi | Matching repeat | DCL dependency |
---|---|---|---|---|---|---|---|
MIR435 | TATCCGGTATTGGAGTTGAGG | 1268.1 | Mature | 21 | DNA/MULE-MuDR | Mermiteh | DCL1 |
TTATCCGGTATTGGAGTTGA | 323.4 | Mature | 20 | DCL1/4 | |||
MIR1850 | CCAAATTCCCAACTTTTCATC | 87.1 | Star | 21 | DNA | Unique | DCL3 |
TTAGTTCACATCAATCTTCCT | 107.8 | Otherd | 21 | DCL4 | |||
MIR1862d,e | TTTGTTTATTTTGGGACGGAG | 27.7 | Othere | 21h | DNA/TcMar-Stowaway | Stowaway47 | DCL4 |
MIR1867 | TAGGACAGAGGGAGTAGATGT | 25.4 | Otherf | 21h | DNA/CMC-EnSpm | EnSpm-11 | DCL1 |
TTTTTCTAGGACAGAGGGAGT | 125.1 | Otherg | 21h | DCL1/4 | |||
MIR1868 | TACTTCCTCGTTTTCCGTAAA | 48.6 | Star | 21h | DNA/PIF-Harbinger | Wanderer | DCL3 |
MIR1884b | TATGACGCTGTTGACTTTT | 7.7 | Otherd | 19h | DNA/TcMar-Stowaway | Stowaway2 | DCL1/3 |
TATGACGCTGTTGACTTTTAGA | 62.3 | Otherd | 22h | DCL1 | |||
TATGACGCTGTTGACTTTTA | 160.7 | Otherd | 20h | DCL3 | |||
TATGACGCTGTTGACTTTTAG | 1515.7 | Otherd | 21h | DCL3/4 | |||
MIR2872 | TTCGGTTTGTAGAATACCATC | 23.1 | Star | 21 | LTR/Gypsy | SZ-42_LTR | DCL1 |
Enriched sequences for each miRNA precursor in the pooled AGO1 datasets. Datasets include GSE18251 (Wu et al. 2009), GSE20748 (Wu et al. 2010), and GSE22763 (Song et al. 2012);
The normalized abundance (transcript per ten million, TP10M) in the pooled AGO1 datasets;
Mapping positions of each sequence on miRNA hairpin (mature: ±2nt of mature miRNA; star: ±2nt of miRNA*; other: any position other than mature and star);
5' end of these species were +4 nt off comparing to annotated mature miRNAs in miRBase;
5' end of these species were +6 nt off comparing to annotated mature miRNAs in miRBase;
5' end of these species were +9 nt off comparing to annotated mature miRNAs in miRBase;
5' end of these species were +3 nt off comparing to annotated mature miRNAs in miRBase;
Annotated mature miRNAs in miRBase are 24-nt long;
DNA, DNA transposons; TcM-Stowaway: parallel homologous groups Tourist class Mariner and Stowaway MITES; LTR, long terminal repeat retrotransposons.