Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2013 Apr;51(4):1291–1293. doi: 10.1128/JCM.03240-12

Modified Hodge Test versus Indirect Carbapenemase Test: Prospective Evaluation of a Phenotypic Assay for Detection of Klebsiella pneumoniae Carbapenemase (KPC) in Enterobacteriaceae

Amy J Mathers a,, Joanne Carroll b, Costi D Sifri a, Kevin C Hazen b,*
PMCID: PMC3666817  PMID: 23390272

Abstract

The currently recommended phenotypic test for the detection of carbapenemase-producing members of the family Enterobacteriaceae is the modified Hodge test (MHT). However, the MHT lacks specificity. Here we demonstrate an alternative phenotypic test, the indirect carbapenemase test, for the detection of blaKPC-producing isolates that has specificity superior to that of the MHT for non-Klebsiella Enterobacteriaceae.

TEXT

The last decade has witnessed the dramatic emergence and worldwide dissemination of carbapenem resistance in Enterobacteriaceae. In the United States, the most common mechanism of carbapenem resistance is the production of the Ambler class A serine β-lactamase Klebsiella pneumoniae carbapenemase (KPC) (1). The blaKPC gene product has the ability to hydrolyze all penicillins, cephalosporins, monobactams, and carbapenem antibiotics, which often leaves clinicians with few therapeutic options. As a consequence, infections due to carbapenemase-producing Enterobacteriaceae (CPE) carry a high mortality rate, reaching 40% or higher in some studies (25).

The blaKPC gene is carried on resistance plasmids that are readily transmitted between bacterial strains and species, making the prevention of in-hospital transmission especially difficult (68). Accurate recognition of CPE in the clinical microbiology laboratory is central to controlling the spread of these organisms in the health care setting (9). However, identification of CPE from clinical isolates can be challenging. Molecular detection of a specific carbapenemase gene is the gold standard, but this method is impractical for many clinical laboratories.

In 2009, the Clinical and Laboratory Standards Institute (CLSI) suggested phenotypic evaluation for the presence of a carbapenemase in Enterobacteriaceae with elevated MICs of one or more carbapenems by using the modified Hodge test (MHT) (9). The MHT has been found to be a useful tool for the detection of CPE but lacks specificity for serine carbapenemases (1013). We previously reported a heterogeneous outbreak of KPC-producing Enterobacteriaceae (7, 14). Starting in late 2009, there was an increase in Enterobacteriaceae isolates (mostly Enterobacter spp.) that were MHT positive but blaKPC PCR negative. This prompted us to prospectively evaluate phenotypic screening approaches for carbapenemase production. Here we compare the MHT and the indirect carbapenemase test (ICT), originally described by Moland et al. (15). Those investigators also described a direct carbapenemase test with imipenem, but we did not use it because some of our isolates expressed such high levels of resistance that no evaluable phenotypic result was possible.

This study was conducted at the University of Virginia Medical Center, a 619-bed tertiary-care hospital in central Virginia, from 1 May 2010 to 31 December 2011. One hundred twenty-seven isolates of Enterobacteriaceae with ertapenem MICs of ≥1 μg/ml were prospectively collected during the study period. Given the heterogeneous nature of our earlier outbreak (7), all species of Enterobacteriaceae were examined. Isolates were collected from urine (n = 67), respiratory (n = 17), blood (n = 12), abdominal (n = 9), wound (n = 7), and other (n = 15) specimens. Isolates were identified and their antibiotic susceptibility profiles were determined by using the VITEK2 system with the GN ID card and the AST-GN45 card (bioMérieux, Durham, NC), respectively. The study population consisted of Enterobacter sp. (n = 74), Klebsiella sp. (n = 38), Citrobacter freundii (n = 8), and Escherichia coli (n = 7) isolates. All isolates were evaluated for carbapenemase production by the MHT and an ICT and for the presence of blaKPC by PCR (14).

The MHT was performed as previously described, with a 10-μg imipenem disk (16). The ICT method uses an EDTA disk. EDTA is used here not as a cation-chelating agent to inhibit metallo-β-lactamases but rather to lyse bacterial cells and release the carbapenemase. For this test, a suspension of a carbapenem-susceptible E. coli strain (ATCC 25922; American Type Culture Collection, Manassas, VA) was prepared in saline equal to a McFarland 0.5 turbidity standard and inoculated onto Mueller-Hinton agar (Remel, Lenexa, KS) to achieve a confluent lawn. Two or three colonies of the test isolate were applied to a 0.1 mM EDTA disk (Becton, Dickinson, Sparks, MD) by touching the tops of a few well-isolated colonies to coat the EDTA disk. The inoculated EDTA disk was placed with the bacterial inoculum (organism) side down on the lawn abutting a 10-μg imipenem disk (Becton, Dickinson). The plate was then incubated overnight at 35°C in ambient air. Indentation of growth toward the imipenem disk indicated a positive test for a serine carbapenemase (Fig. 1). Weekly quality controls for the ICT were K. pneumoniae ATCC strains 1705 (MHT and blaKPC positive) and 1706 (MHT and blaKPC negative).

Fig 1.

Fig 1

ICT with imipenem. Two or three colonies of the test isolate are under each EDTA disk. (A) Negative test without invagination of carbapenem-susceptible E. coli ATCC 25922 growth. (B) Positive test with invagination of the lawn.

To detect blaKPC and other carbapenemases, DNA was obtained by suspending one or two colonies of each test isolate in 100 μl of nuclease-free water and heating it at 95°C for 10 min. Samples were spun at 10,000 rpm for 1 min. The resulting supernatant was used as the bacterial DNA template for PCR. PCR amplification of blaKPC was performed as previously described (14). All isolates that had a positive phenotypic test and were PCR negative for blaKPC also underwent PCR assays for other carbapenemases (blaVIM, blaOXA-48-like, and alternative primers for blaKPC) using previously described primers (17) and for blaNDM-directed PCR (5′-3′ forward, GGTTTGGCGATCTGGTTTTC; 5′-3′ reverse, CGGAATGGCTCATCACGATC) under the same conditions used for the KPC PCR. All reaction mixtures had positive controls. A positive blaKPC PCR result was used as the true positive in the evaluation of MHT and ICT sensitivity and specificity. The presence of blaIPM was not tested because of the lack of a positive control and because blaIPM has been described only once for Enterobacteriaceae (K. pneumoniae) in the United States (18).

In total, 44% (56/127) of the isolates evaluated (i.e., with ertapenem MICs of ≥1 μg/ml) were found to be blaKPC positive. The presence of blaKPC varied by species; 24% (18/74) of the Enterobacter sp. isolates, 75% (6/8) of the C. freundii isolates, and 84% (32/38) of the Klebsiella sp. isolates were blaKPC positive. Interestingly, all seven E. coli isolates with elevated ertapenem MICs identified during the study period were blaKPC negative.

blaKPC-positive isolates generally had higher ertapenem and imipenem MICs (correlation coefficients, 0.61 and 0.68, respectively) than blaKPC-negative isolates. Cefepime MICs did not have the same association with KPC (correlation coefficient, 0.21). Fifty-five percent of the blaKPC-producing isolates were considered cefepime susceptible (16). The median MICs of ertapenem, imipenem, and cefepime for the blaKPC-negative and blaKPC-positive isolates were 2, ≤1, and ≤1 μg/ml and ≥8, 4, and 8 μg/ml, respectively.

The results, broken down by blaKPC PCR results, are shown in Table 1. The overall sensitivity of the ICT was 90.0%, and that of the MHT was 92.7% (Table 2). The lack of sensitivity of the ICT was seen entirely in the K. pneumoniae population, where the ICT had a sensitivity of 83.9%. The overall specificity of the ICT was 95.8%, and that of the MHT was 63.4%. Both the ICT and the MHT had false positives with Enterobacter spp. and C. freundii, but only the MHT gave false-positive results with E. coli. Positive MHT and negative KPC PCR results were obtained with all four Enterobacter species tested (Enterobacter cloacae, E. aerogenes, E. amnigenus, and E. asburiae).

Table 1.

Correlation of phenotypic test results with K. pneumoniae carbapenemase (blaKPC) PCR results organized by speciesa

Test result All isolates (n = 127)
Klebsiella spp. (n = 38)
Enterobacter spp. (n = 74)
C. freundii (n = 8)
E. coli (n = 7)
blaKPC PCR positive (n = 56) blaKPC PCR negative (n = 71) blaKPC PCR positive (n = 32) blaKPC PCR negative (n = 6) blaKPC PCR positive (n = 18) blaKPC PCR negative (n = 56) blaKPC PCR positive (n = 6) blaKPC PCR negative (n = 2) blaKPC PCR positive (n = 0) blaKPC PCR negative (n = 7)
MHT positive 52 26 29 0 17 21 6 2 0 3
MHT negative 4 45 3 6 1 35 0 0 0 4
ICT positive 51 3 27 0 18 2 6 1 0 0
ICT negative 5 68 5 6 0 54 0 1 0 7
a

All data are numbers of isolates.

Table 2.

Performance characteristics of the MHT versus those of the ICT

Parameter All species (n = 127)
Enterobacter spp. (n = 74)
Klebsiella spp. (n = 38)
C. freundii (n = 8)
E. coli (n = 7)
ICT MHT ICT MHT ICT MHT ICT MHT ICT MHT
Sensitivity (%) 90.0 92.7 100 94.4 84.3 90.3 100 100 NAa NA
Specificity (%) 95.8 63.4 96.4 62.5 100 100 50.0 0 100 57.1
Positive predictive value (%) 94.4 66.7 89.5 44.7 100 100 85.7 75.0 NA 0
Negative predictive value (%) 93.1 91.8 100 97.2 54.5 66.7 100 NA 100 100
Likelihood ratio positive 22.5 2.53 27.8 2.51 Infinite Infinite 2 1
Likelihood ratio negative 0.10 0.12 0 0.09 0.16 0.1 0 0
a

NA, not applicable.

The negative likelihood ratios of the MHT and the ICT are roughly equivalent (Table 2). However, the positive likelihood ratio of the ICT is >10-fold higher than that of the MHT and 2-fold higher for Enterobacter spp. and C. freundii, respectively.

Among the 26 blaKPC-negative isolates with positive phenotypic test results (3 ICT positive, 26 MHT positive, and 2 both ICT and MHT positive), blaVIM-1,2, blaOXA-48, and blaNDM carbapenemases were not detected by molecular analysis.

Accurate determination of whether an isolate produces a carbapenemase can inform treatment, as several studies have shown the superiority of combination therapy when KPC is present even when the MICs remain low (4, 5, 19). Noteworthy in this study is the finding that five of the blaKPC-positive isolates had imipenem MICs of ≤1 μg/ml. We also found 26 MHT-positive, blaKPC-negative isolates. It is not clear that these isolates pose the same infection control risk as KPC-producing Enterobacteriaceae (2). The sensitivity for the identification of KPC-producing K. pneumoniae was lower with the ICT than with the MHT. Therefore, the ICT may not be the ideal screening test for the detection of KPC production among K. pneumoniae isolates.

The present study suggests that the MHT advocated by the CDC and the CLSI has specificity inferior to that of the ICT for the detection of carbapenemase production by KPC-producing non-Klebsiella Enterobacteriaceae. The ICT can assist clinical laboratories in accurately identifying Enterobacter sp., C. freundii, and E. coli isolates that do not harbor blaKPC yet have an elevated ertapenem MIC.

Footnotes

Published ahead of print 6 February 2013

REFERENCES

  • 1. Gupta N, Limbago BM, Patel JB, Kallen AJ. 2011. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin. Infect. Dis. 53:60–67 [DOI] [PubMed] [Google Scholar]
  • 2. Livermore DM, Andrews JM, Hawkey PM, Ho PL, Keness Y, Doi Y, Paterson D, Woodford N. 2012. Are susceptibility tests enough, or should laboratories still seek ESBLs and carbapenemases directly? J. Antimicrob. Chemother. 67:1569–1577 [DOI] [PubMed] [Google Scholar]
  • 3. Patel G, Huprikar S, Factor SH, Jenkins SG, Calfee DP. 2008. Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect. Control Hosp. Epidemiol. 29:1099–1106 [DOI] [PubMed] [Google Scholar]
  • 4. Souli M, Galani I, Antoniadou A, Papadomichelakis E, Poulakou G, Panagea T, Vourli S, Zerva L, Armaganidis A, Kanellakopoulou K, Giamarellou H. 2010. An outbreak of infection due to beta-lactamase Klebsiella pneumoniae carbapenemase 2-producing K. pneumoniae in a Greek University Hospital: molecular characterization, epidemiology, and outcomes. Clin. Infect. Dis. 50:364–373 [DOI] [PubMed] [Google Scholar]
  • 5. Zarkotou O, Pournaras S, Tselioti P, Dragoumanos V, Pitiriga V, Ranellou K, Prekates A, Themeli-Digalaki K, Tsakris A. 2011. Predictors of mortality in patients with bloodstream infections caused by KPC-producing Klebsiella pneumoniae and impact of appropriate antimicrobial treatment. Clin. Microbiol. Infect. 17:1798–1803 [DOI] [PubMed] [Google Scholar]
  • 6. Kim YA, Qureshi ZA, Adams-Haduch JM, Park YS, Shutt KA, Doi Y. 2012. Features of infections due to Klebsiella pneumoniae carbapenemase-producing Escherichia coli: emergence of sequence type 131. Clin. Infect. Dis. 55:224–231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Mathers AJ, Cox HL, Kitchel B, Bonatti H, Brassinga AK, Carroll J, Scheld WM, Hazen KC, Sifri CD. 2011. Molecular dissection of an outbreak of carbapenem-resistant enterobacteriaceae reveals intergenus KPC carbapenemase transmission through a promiscuous plasmid. mBio 2(6):e00204–00211 doi:10.1128/mBio.00204-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the beta-lactamase bla KPC gene. Antimicrob. Agents Chemother. 52:1257–1263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. CDC 2009. Guidance for control of infections with carbapenem-resistant or carbapenemase-producing Enterobacteriaceae in acute care facilities. MMWR Morb. Mortal. Wkly. Rep. 58:256–260 [PubMed] [Google Scholar]
  • 10. Birgy A, Bidet P, Genel N, Doit C, Decre D, Arlet G, Bingen E. 2012. Phenotypic screening of carbapenemases and associated beta-lactamases in carbapenem-resistant Enterobacteriaceae. J. Clin. Microbiol. 50:1295–1302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Carvalhaes CG, Picao RC, Nicoletti AG, Xavier DE, Gales AC. 2010. Cloverleaf test (modified Hodge test) for detecting carbapenemase production in Klebsiella pneumoniae: be aware of false positive results. J. Antimicrob. Chemother. 65:249–251 [DOI] [PubMed] [Google Scholar]
  • 12. Liao IC, Chen HM, Wu JJ, Tsai PF, Wang LR, Yan JJ. 2011. Metallo-beta-lactamase-producing Enterobacteriaceae isolates at a Taiwanese hospital: lack of distinctive phenotypes for screening. APMIS 119:543–550 [DOI] [PubMed] [Google Scholar]
  • 13. Wang P, Chen S, Guo Y, Xiong Z, Hu F, Zhu D, Zhang Y. 2011. Occurrence of false positive results for the detection of carbapenemases in carbapenemase-negative Escherichia coli and Klebsiella pneumoniae isolates. PLoS One 6:e26356 doi:10.1371/journal.pone.0026356 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Mathers AJ, Cox HL, Bonatti H, Kitchel B, Brassinga AK, Wispelwey B, Sawyer RG, Pruett TL, Hazen KC, Patel JB, Sifri CD. 2009. Fatal cross infection by carbapenem-resistant Klebsiella in two liver transplant recipients. Transpl. Infect. Dis. 11:257–265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Moland ES, Kim S-Y, Hong SG, Thomson KS. 2008. Newer β-lactamases: clinical and laboratory implications, part II. Clin. Microbiol. Newsl. 30:79–85 [Google Scholar]
  • 16. CLSI 2012. Performance standards for antimicrobial susceptibility testing. M100-S22, 22nd informational supplement. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 17. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65:490–495 [DOI] [PubMed] [Google Scholar]
  • 18. Limbago BM, Rasheed JK, Anderson KF, Zhu W, Kitchel B, Watz N, Munro S, Gans H, Banaei N, Kallen AJ. 2011. IMP-producing carbapenem-resistant Klebsiella pneumoniae in the United States. J. Clin. Microbiol. 49:4239–4245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Tumbarello M, Viale P, Viscoli C, Trecarichi EM, Tumietto F, Marchese A, Spanu T, Ambretti S, Ginocchio F, Cristini F, Losito AR, Tedeschi S, Cauda R, Bassetti M. 2012. Predictors of mortality in bloodstream infections caused by Klebsiella pneumoniae carbapenemase-producing K. pneumoniae: importance of combination therapy. Clin. Infect. Dis. 55:943–950 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES