Figure 4.

PU.1 and Ikaros activate Sfpi1 enhancers in myeloid cells, but Ikaros suppresses the URE enhancer in pre-B-cells. (a) PU.1 and Ikaros target sites in CE5 are required for enhancer activity in RAW264.7 myeloid cells. Schematic shows the CE5 region spanning the CE5-P2 probe and flanking sequence. Nucleotides mutated in the CE5 region of the L5-3 Sfpi1 reporters are shown in red. Data show the average fold increases in activity of L5-3 and mutated reporters relative to L1, with error bars representing standard deviations. Data are from three independent experiments each performed in duplicate. Reporter plasmids (4 μg) were cotransfected with 0.25 μg of control plasmid pCMV-RL into 5-6 million cells. For transfection conditions see below. Cells were harvested ~24 hours post transfection for analysis. (b) Anti-PU.1 morpholino antisense oligonucleotides can knock down PU.1 protein expression. 32Dcl5 myeloid precursor cells were used to test the morpholinos and were grown in RPMI medium supplemented with IL-3. Morpholinos E1, overlaps exon1/intron1 boundary; and E2, overlaps exon2/intron2 boundary were ordered from Gene Tools, Inc.: anti-PU.1 (E2) GAGGACCAGGTACTCACCGCTATG; anti-PU.1 (E1) GTAGTGAAGCCCCAGTACTCACAGG; Standard Control oligo CCTCTTACCTCAGTTACAATTTATA. 32Dcl5 cells were nucleofected with 2 picomoles of morpholinos using Solution-V kits and program E-32. Cell samples were harvested for analysis at 24 and 48 hours. The Western blot was probed using anti-PU.1 antibody (sc-5948) and anti-Ets-1 (sc-350) as a control. (c) PU.1 knockdown abolishes L7-5 reporter activity. (d) Ikaros contributes to myeloid enhancer activity in RAW264.7 cells. (e) Ikaros suppresses URE enhancer activity in NFS-25 pre-B-cells. Raw264.7 and NFS-25 cells were cotransfected with Sfpi1 reporters and pEF empty vector (EV) or pEF-Plastic (Ikaros dominant negative). Transfection data in each panel (c-e) are from three independent experiments performed in duplicate. Error bars show standard deviations. Data are shown as fold difference relative to L1+Control (c) or L1+pEF (d,e). RAW264.7 cells were transfected with Sfpi1 reporters and 2 picomoles of standard control morpholino or anti-PU.1 morpholino. Transfection and cotransfection were performed by Nucleofection (Lonza/Amaxa) using Solution-V kits and program D-32 for RAW264.7 cells or program A-33 for NFS-25 cells. (f) Schematic depicts cell-type-specific patterns of PU.1 and Ikaros binding to Sfpi1 cis-elements and the differences in their functional consequences for transcriptional control.