Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| No | Cloning/BAC engineering purpose | Primer sequence (5′→3′) |
|---|---|---|
| 1 | HOT1 homeobox domain deletion, forward primer | CTGCGACGAGGGAGTGCCAATATTGAAGCAGCAATCCTGG |
| 2 | HOT1 homeobox domain deletion, reverse primer | TGCTTCAATATTGGCACTCCCTCGTCGCAGTCGGAAAGTA |
