TABLE 1.
Primers used in this study
| Primer | Nucleotides | Sequence |
|---|---|---|
| bssAf | 8009-8027a | TGGGTCAACGTGCTGTGCA |
| bssAr | 9034-9017a | GCCGGATACGCGCACGAT |
| todA-RT | 3483-3463b | GTTACGGTTCGCGCCGCATTC |
| todAf | 2879-2899b | CTTAGCGGTGAGCGCAGTGTG |
| todAr | 3208-3188b | CCACGATGTAGCGACTTGGGG |
| bssA-RT | 2318-2298c | CTGGCGCTTCGGATCGGTTTC |
| bssAf-2 | 1846-1866c | CGCTGTATCCCGAACTGTCCC |
| bssAr-2 | 2166-2146c | AGGGGAAGGTGGACATATCGC |
a
The positions correspond to the positions of the nucleotide sequence deposited in GenBank/EMBL/DDBJ Nucleotide Sequence Data Library under accession number AJ001848.
b
The positions correspond to the positions of the nucleotide sequence deposited in GenBank/EMBL/DDBJ Nucleotide Sequence Data Library under accession number AB066264.
c
The positions correspond to the positions of the nucleotide sequence deposited in GenBank/EMBL/DDBJ Nucleotide Sequence Data Library under accession number AB066263.