Table 2.
Primer sequence and number of polymorphic site of nine chloroplast genome regions of 67 accessions of Cucumis species
| Regiona | Gene name | Marker name | Forward (F), Reverse (R) primer (5′ to 3′)b | Marker position (bp) | Aligned length (bp)c | Gap (bp)c | Total no. of site (bp)c | SNPc | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
||||||||||
| Position | Length | No. | % | ||||||||
| LSC | TrnK-MatK | Cmcp1 | F | AACCCGGAACTAGTCGGATGG | 1,638–1,658 | 388 | 390 | 3 | 387 | 21 | 5.4 |
| R | TCGGAATTATTGGAAGAATTCTT | 2,069–2,047 | 388 | – | 388 | 3 | 0.8 | ||||
| Rps16 intron1 | Cmcp2 | F | GAAGTTTTCTCCTCGTACGGC | 5,231–5,251 | 609 | 617 | 14 | 603 | 30 | 5.0 | |
| R | GATGGAGCTCGAGTAGAAAGTAT | 5,883–5,861 | 612 | 4 | 608 | 3 | 0.5 | ||||
| PsbK-PsbI | Cmcp3 | F | TGTTTGGCAAGCTGCTGTAAG | 7,996–8,016 | 377 | 387 | 24 | 363 | 32 | 8.8 | |
| R | GAGAGTAAGCATTACACAATCTCCAAG | 8,420–8,394 | 373 | 5 | 368 | 2 | 0.5 | ||||
| AtpH-AtpI | Cmcp5 | F1 | AATAACGGAAGCGGCAGAAAT | 14,556–14,576 | 976 | 946 | 53 | 893 | 49 | 5.5 | |
| R1 | AGCTCTTATTTTTGCAACTTTAGC | 15,576–15,553 | 920 | – | 920 | 6 | 0.7 | ||||
| F2 | GGTTGTCTTATAGCAATTCGATTC | 15,086–15,109 | |||||||||
| R2 | CATGAACTTAGATTAATAAAATATTG | 15,288–15,263 | |||||||||
| PsbC-TrnS | ccSSR 7 | F | CGGGAAGGGCTCGKGCAG | 37,185–37,202 | 297 | 276 | 12 | 264 | 14 | 5.3 | |
| R | GTTCGAATCCCTCTCTCTCCTTTT | 37,523–37,500 | 276 | 5 | 271 | 1 | 0.4 | ||||
| PsaI-Ycf4 | Cmcp15 | F | TCGAGGTATCCATTCTATGAC | 61,339–61,359 | 534 | 569 | 44 | 525 | 37 | 7.0 | |
| R | ATCCATATACGTTCTGATCGC | 61,914–61,894 | 557 | 25 | 532 | 1 | 0.2 | ||||
| Rpl16-Rpl14 | PS-ID | A | AAAGATCTAGATTTCGTAAACAACATAGAGGAAGAA | 83,600–83,565 | 504 | 474 | 14 | 460 | 13 | 2.8 | |
| B | ATCTGCAGCATTTAAAAGGGTCTGAGGTTGAATCAT | 83,025–83,060 | 474 | 4 | 470 | 2 | 0.4 | ||||
|
| |||||||||||
| SSC | NdhF-Rpl32 | Cmcp6 | F | GAGATGAACGGTATGATCCATGA | 114,328–114,350 | 679 | 720 | 258 | 462 | 29 | 6.3 |
| R | TCCGTTTTTTTGATATAGAAGTGCG | 115,049–115,025 | 676 | 3 | 673 | 6 | 0.9 | ||||
| NdhA intron1 | Cmcp11 | F1 | TATAGGTTGACGCCACAAATTC | 122,070–122,091 | 1,213 | 1,254 | 88 | 1,166 | 59 | 5.1 | |
| R1 | ATCAATATCTCTACGTGTGATTCG | 123,328–123,305 | 1,215 | 33 | 1,182 | 6 | 0.5 | ||||
| F2 | TTGTAATTGGATTCTTTCCATT | 122,650–122,671 | |||||||||
| R2 | GATATTTTTTATTGTTTCTTATCTCC | 122,634–122,609 | |||||||||
|
| |||||||||||
| Total | 5,577 | 5,633 | 510 | 5,123 | 284 | 5.5 | |||||
| 5,491 | 79 | 5,412 | 30 | 0.6 | |||||||
a
LSC and SSC indicate large- and small-single copy region in the chloroplast genome, respectively. Gene name, maker position and marker length refer to the melon chloroplast genome (accession No. JF412791).
b
K = T or G
c
The upper side and the lower side value of each region were calculated for 67 accessions of Cucumis and 60 melon accessions, respectively.
Total number of site = (Aligned length) − (Gap).