Table 1. Polymerase chain reaction primers used for the amplification and sequencing of the PVH genome.
Primer name | Sequence (5' to 3') | Nucleotide position | Polarity | Method |
---|---|---|---|---|
PoleR5 | CYCAKYTCCATSWYYC | Antisense | Reverse transcription | |
PL001F | ACAAAAGAATACCAGGAGGAATTGC | Sense | ||
PLN1674R | GACTTGTGGAGGCTTGTGAAAG | Antisense | ||
Carla114F | ATGGCWYTNACWTAYAGRASKCC | 092-114nt | Sense | Degenerate PCR |
Carla900F | GGACGATGGGCAGGTGTAC | 855-873nt | Sense | |
Car1340F | GTGGCGCTTGATAGGAAATC | 1468-1487nt | Sense | |
Carla1763F | GCCCGTTACAGTCGCGCCAG | 1756-1775nt | Sense | |
Carla3357R | GCTAATTTCGTAGACCAGAGAG | 3336-3357nt | Antisense | Specific primer |
Carla3226F | CTCGAGTACCTAGAGAGGAAGAG | 3226-3248nt | Sense | Specific primer |
Carla3600R | GTAGTTCGATGCCTCATGC | 4839-4857nt | Antisense | |
Carla4211R | CTATTCTCGAATTTTGGGTTG | 3954-3974nt | Antisense | |
Carla4610F | CAAGGTGGGTGCACAAAATC | 4604-4623nt | Sense | |
Carla5040R | CTATATCCACTAACCAATCCCTGC | 5006-5029nt | Antisense | |
Carla5468F | CCATGGCCAATATGCTTTTCAC | 5468-5489nt | Sense | Specific primer |
Carla5672R | CCATCAGCGCATAAGTTCCACC | 5651-5672nt | Antisense | Specific primer |
Carla5800F | CAGATTACACTTGCAACAGAAG | 5029-5050nt | Sense | |
Carla6670F | GGCTGACGACAAGAAGGG | 7170-7187nt | Sense | |
HC511-18TR | GG A T A T CTGCAG G A T C CAAGC(T)18 | PolyA | Antisense | Reverse transcription |
HC511R | GG A T A T CTGCAG G A T C CAAGC | Antisense | Anchored primer |
a The underlined sequences are the restriction sites specific for EcoRV (GAT↓ ATC) and BamHI (G↓ GATCC). Protection bases are included in the 5' termini.