Skip to main content
PLOS One logoLink to PLOS One
. 2013 Jun 28;8(6):e66465. doi: 10.1371/journal.pone.0066465

Cell Lineage Identification and Stem Cell Culture in a Porcine Model for the Study of Intestinal Epithelial Regeneration

Liara M Gonzalez 1,2, Ian Williamson 4,6, Jorge A Piedrahita 1,3, Anthony T Blikslager 1,2, Scott T Magness 4,5,6,*
Editor: Shree Ram Singh7
PMCID: PMC3696067  PMID: 23840480

Abstract

Significant advances in intestinal stem cell biology have been made in murine models; however, anatomical and physiological differences between mice and humans limit mice as a translational model for stem cell based research. The pig has been an effective translational model, and represents a candidate species to study intestinal epithelial stem cell (IESC) driven regeneration. The lack of validated reagents and epithelial culture methods is an obstacle to investigating IESC driven regeneration in a pig model. In this study, antibodies against Epithelial Adhesion Molecule 1 (EpCAM) and Villin marked cells of epithelial origin. Antibodies against Proliferative Cell Nuclear Antigen (PCNA), Minichromosome Maintenance Complex 2 (MCM2), Bromodeoxyuridine (BrdU) and phosphorylated Histone H3 (pH3) distinguished proliferating cells at various stages of the cell cycle. SOX9, localized to the stem/progenitor cells zone, while HOPX was restricted to the +4/‘reserve’ stem cell zone. Immunostaining also identified major differentiated lineages. Goblet cells were identified by Mucin 2 (MUC2); enteroendocrine cells by Chromogranin A (CGA), Gastrin and Somatostatin; and absorptive enterocytes by carbonic anhydrase II (CAII) and sucrase isomaltase (SIM). Transmission electron microscopy demonstrated morphologic and sub-cellular characteristics of stem cell and differentiated intestinal epithelial cell types. Quantitative PCR gene expression analysis enabled identification of stem/progenitor cells, post mitotic cell lineages, and important growth and differentiation pathways. Additionally, a method for long-term culture of porcine crypts was developed. Biomarker characterization and development of IESC culture in the porcine model represents a foundation for translational studies of IESC-driven regeneration of the intestinal epithelium in physiology and disease.

Introduction

Complete physiologic renewal of the intestinal epithelium occurs in approximately one week and is driven by a pool of IESCs at the crypt base [1]. This impressive rate of renewal is tightly controlled in homeostasis. Dysregulation of IESC renewal results in intestinal disorders such as small intestinal and colorectal cancer, which is the leading cause of digestive disease-related mortality [2], [3]. Impaired epithelial renewal can lead to ulceration, chronic inflammatory responses and sepsis [4], [5]. Since the description of IESCs in 1974 by Cheng and Lebond, investigators have attempted to understand the factors that control IESC-driven epithelial regeneration in physiology and disease [6].

In general, logistical and ethical issues minimize the use of humans or human- derived tissues for research and discovery pertaining to conditions of the intestinal epithelium. These obstacles highlight the need for a research model that closely mimics human intestinal anatomy, physiology, disease and injury processes. Currently, the vast majority of basic studies focused on intestinal epithelial diseases, injury and regeneration utilize rodent models. Rats and mice in particular represent an important, cost effective animal model for basic genetic, cellular and molecular biology of IESC-driven regeneration of the intestinal epithelium. Despite these advantages, significant differences between rodents and humans confound or prohibit translational studies [7].

Important anatomical, behavioral and environmental conditions that impact epithelial regeneration are more closely shared between pigs and humans than between mice and humans [8], [9]. Pigs and humans share parallel mucosal barrier physiology, food intake, enteric microbiota composition, and pathogenicity of key disease causing microbes [7]. Pigs, like humans, are true omnivores and share similar metabolic and intestinal physiologic processes [7], [9]. A mucosal in vitro permeability study demonstrated greater correlation between humans and pigs when compared to rats [8]. Importantly, it has been demonstrated that pigs represents a more physiologically relevant model of neonatal necrotizing enterocolitis, intestinal ischemia-reperfusion injury, acute mesenteric ischemia, short bowel syndrome, AIDS-associated opportunistic Cryptosporidium infection, and stress-induced intestinal dysfunction [10][22]. Additionally, a large animal model is likely to serve as a more physiological relevant model to study segmental assessment of radiation exposure, focally induced ischemia and reperfusion as well as transplantation and cell-based therapies.

Severe intestinal disease necessitates approximately 200 intestinal transplantations each year in the United States [2]. In a prospective cross-sectional study of patients, 40% of visceral allograft recipients died within 5 years of transplantation [23]. The impact of digestive disease on rates of mortality and morbidity as well as health care costs in the United States has created an urgent need for advances in transplantation and tissue replacement therapies [2]. A key factor to the success of many translational studies is the gross size of the animal model. The small size of the intestines of experimental rodent models often prohibits tissue manipulation or implementation of candidate surgical interventions such as tissue engraftment or transplantation. These limitations further highlight the need for a large animal model to advance cell or tissue based therapies.

This study focuses on eliminating many of the obstacles that limit the pig as a translational model to study IESC-driven regeneration of the intestinal epithelium. This work thoroughly characterizes the porcine intestinal mucosa by identifying, developing and validating a comprehensive set of reagents to study porcine stem/progenitor cells and their principal post-mitotic cell descendants in situ and in culture.

Materials and Methods

Ethics Statement

All animal studies were approved by the Institutional Animal Care and use Committee at North Carolina State University.

Animals and sample collection

Tissues were obtained from healthy 6–8 week-old wild type Yorkshire cross pigs euthanized for reasons unrelated to this project. Sections from the gastrointestinal tract including the duodenum, jejunum, ileum, proximal and distal colon were sharply dissected.

Histological and Immunofluorescence Analyses

Tissues were rinsed with 1× phosphate-buffered saline (PBS) and opened longitudinally along the anti-mesenteric boarder. For immunohistochemical analysis, tissue was fixed in 10% formalin, embedded in paraffin and sectioned (∼5–8 μm thickness). Slides were stained with hematoxylin and eosin to visualize crypt and villus morphology. For immunofluorescence, rinsed tissue was fixed in 4% paraformaldehyde (PFA) solution for 14–18 hours at 4°C. The tissue was transferred to 30% sucrose solution for at least 24 hours at 4°C, embedded in optimal cutting temperature (OCT) media, frozen and sectioned at 5–8 μm thickness using a cryotome and mounted on positively charged glass slides. Sections were washed three times with PBS to remove OCT. When necessary, heat induced epitope retrieval (HIER) was then performed by placing slides into reveal decloaker solution (Biocare Medical, Concord, CA) for 30 seconds at 120°C and then 90°C for 10 seconds, in a pressure cooker. The slides were allowed to cool at room temperature for 20 min prior to continuing. Tissue permeabilization was performed on all slides with PBS-0.3% Triton X-100 for 20 min, washed twice with PBS and incubated in blocking medium (Dako, Carpinteria, CA). Primary antibodies were applied to the tissue section in an antibody diluent (Dako) and incubated overnight at 4°C. Dilutions for functional antibodies were as follows: αSOX9 (rabbit, 1∶1000, Chemicon/Millipore, Temecula, CA), αMucin2 (rabbit; 1∶1000, Santa Cruz Biotechnology, Santa Cruz, CA), αLectin from Ulex europaeus-Atto 488 conjugate (1∶500, Sigma-Aldrich, St. Louis, MO), αsucrase isomaltase (goat, 1∶500, Santa Cruz Biotechnology), αCD326/EpCAM (rat, 1∶500, BioLegend, San Diego, CA), αVillin (goat, 1∶500, Santa Cruz Biotechnology), αCleaved Caspase 3 (rabbit, 1∶400, Cell Signaling Technology, Inc., Danvers, MA), αGlucagon (rabbit, 1∶250, Santa Cruz Biotechnology), αSomatostatin (goat, 1∶500, Santa Cruz Biotechnology), αCarbonic Anhydrase (goat, 1∶250, Santa Cruz Biotechnology), αProliferating cell nuclear antigen (mouse, 1∶100, Chemicon/Millipore), αSP-1 Chromogranin A (Bovine) (rabbit, 1∶1000, Immunostar, Hudson, WI), αSP-1 Chromogranin A (Porcine) (rabbit; 1∶1000, Immunostar), αBeta-catenin (mouse, 1∶200, Cell signaling technology, Inc.), αMinichromosome Maintenance Complex 2 (Goat, 1∶200, Santa Cruz Biotechnology) and αPhospho-histone H3 (rabbit, 1∶200, Cell Signaling technology, Inc.). The BrdU staining protocol was performed on donated tissue from animals treated as described using a monoclonal antibody against BrdU (mouse; 1∶100, Dako) [24]. All secondary antibodies (Jackson ImmunoResearch or Sigma, conjugated to Dylight 488, Cy 3 or Alexafluor 555) were diluted 1∶500, and counter stained with bisBenzimide H 33258 nuclear stain (1∶1000, Sigma). Background staining was negligible as determined by nonspecific IgG staining. Images were captured on an inverted fluorescence microscope (Olympus IX81, Tokyo, Japan) fitted with a digital camera (ORCA-flash 4.0 or -03G, Hamamatsu, Japan). The objective lenses used were X10, X20 and X40 with numerical apertures of 0.3, 0.45 and 0.6, respectively (LUC Plan FLN, Olympus, Tokyo, Japan). Immunohistochemically stained slides were imaged with an Olympus Bx45 microscope fitted with and Olympus DP72 camera. The objective lenses used were X10, X20 and X100 with numerical apertures of 0.3, 0.5 and 1.3 oil, respectively (UPlanFLN, Olympus).

Appropriate antibody specificity to cellular biomarker was supported by western blot analysis (Table 1), known localization from published immunofluorescence imaging of porcine [10], [24][27] and mouse studies [28][32], as well as consistent repeatability of staining and appropriate localization along the crypt villus axis.

Table 1. Functional/Cross Reactive Antibodies.

Protein Company Catalog # Host Species Dilution 1° Atb Antigen Retrieval Functional for Western Blot/Band (KDa)
IESC
SOX9 Millipore ab5535 rabbit 1:1000 Yes Yes (56–65)
HOPX Santa Cruz sc-30216 rabbit 1:500 Yes
Proliferative
PCNA Millipore MAB424R mouse 1:100 Yes Yes (36)
Goblet
MUC2 Santa Cruz sc-15334 rabbit 1:1000 No
UEA-1 Sigma 19337 Atto 488 1:500 No
Enteroendocrine
CgA Immunostar 20086 (Porcine) rabbit 1:1000 Yes Yes (75)
CgA Immunostar 20085 (Bovine) rabbit 1:1000 No
Gastrin Santa Cruz sc-7783 Goat 1:250 Yes
Glucagon Santa Cruz sc-13091 rabbit 1:250 No
Somatostatin Santa Cruz sc-7819 Goat 1:500 No
Absorptive Endocrine
Sucrase Isomaltase Santa Cruz sc-27603 Goat 1:500 Yes Yes (200)
CAII Santa Cruz sc-17244 Goat 1:250 No Yes (29)
CAII Santa Cruz sc-17246 Goat 1:500 Yes
Epithelial
EpCAM Biolegend 118212 mouse 1:500 No
Villin Santa Cruz sc-7672 Goat 1:500 Yes
Apoptosis and Cell Cycle
Caspase 3 Cell Signaling 9661S Rabbit 1:400 Yes
Phosph-histone H3 Cell Signaling 9701 Rabbit 1:200 Yes
Phospho-histone H3 Millipore 6–570 Rabbit 1:500 Yes
MCM2 Santa Cruz Sc-9839 Goat 1:200 Yes
Beta catenin Cell Signaling 2677 mouse 1:200 Yes

qRT-PCR

The jejunal mucosa was physically separated from seromuscular layers by scraping with a glass slide and was placed in RNAse free microtubes and immediately placed in liquid nitrogen. They were then stored at −80°C until use. Total RNA from jejunal tissue was extracted using the Qiagen RNeasy Minikit (Qiagen, Valencia, CA). Yield and quality of the extracts were determined by measuring absorbance at 260 and 280 nm (NanoDrop Technologies Thermo Fisher Scientific Wilmington, DE). The ratio of absorbance at 260∶280 was between 2.03 and 2.07. 1 µg of RNA was converted to cDNA using the iScript cDNA synthesis kit (Biorad) and pooled. The cycle conditions were 5 min at 25°C, cDNA synthesis at 42°C for 30 min, denaturation at 85°C for 5 min and held at 4°C. Primers were designed based on published sequences of the pig target genes either manually or using the NCBI online primer design tool (Primer-BLAST, http://www.ncbi.nlm.nih.gov/tools/primer-blast/), Primer3 input (version 0.4.0, frodo.wi.mit.edu/). The specificity of the primers was checked using the NCBI online Blast tool (Primer-BLAST, http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative RT-PCR was performed utilizing the iTaq Universal SYBR green Supermix (BioRad). Standard curves were generated using serial dilutions of pooled cDNA from all three normal pigs tested in triplicate. The StepOnePlus Real time PCR system (Applied Biosystems by Life Technologies, Carlsbad, CA) was used. Cycle parameters included polymerase activation and DNA denaturation at 95°C for 30 sec. Forty cycles of amplification were performed with a 15 sec denaturation at 95°C and annealing/extension and plate read for 60 sec at 60°C. The melting curve analysis was performed at 65°C–95°C at 0.5°C increments, 5 sec per step. Melting curves were checked to ensure consistent amplification of a single PCR product. Primer efficiency was calculated using the equation, Efficiency  = 10(−1/slope) –1. All primer efficiencies were greater than 92%.

Target validation by sequencing

RT-PCR amplicons were analyzed on a 1.5% Agarose TE gel to assess size. The amplicons were purified using the USB ExoSAP-IT PCR product cleanup reagent (Affymetrix, Santa Clara, CA). Samples were sequenced (GENEWIZ, Research Triangle Park, NC), and the sequences were aligned to the gene target using the NCBI online Blast tool and Vector NTI alignment program (Life Technologies) for validation.

Transmission Electron Microscopy

TEM imaging was performed by the laboratory for advanced electron and light optic methods at North Carolina State University. The tissue fixation, preparation and image acquisition were performed as previously published [6], [33], [34].

Crypt isolation, Enteroid Culture and Analysis

Tissue was taken from 2–14 day-old wild type Yorkshire piglets euthanized for other research purposes. An 8–10 cm segment of distal duodenum/proximal jejunum was surgically excised and opened longitudinally. The tissue was incubated for 20 min in a phosphate-buffered saline solution (PBS) containing 30 mM Ethylenediaminetetraacetic acid (EDTA), 10 µM Y-27632 (Selleck, Houston, TX), 1mM DTT (Sigma-Aldrich), and 100 µg/mL penicillin/streptomycin at 4°C on an orbital shaking platform moving at 80 rpm. Tissue was transferred into a 37°C pre-warmed PBS solution containing 30 mM EDTA, 10 µM Y-27632, and 100 µg/mL penicillin/streptomycin. The tissue was incubated in this solution at 37°C for 10 min and then shaken at 2.5 cycles sec-1 to mobilize the crypt/villi units. If the desired yield was not achieved, the tissue was incubated in solution at 37°C for an additional 2 min and shaken for an additional 30 sec up to 5 times. Longer incubations caused extremely poor survival. Following the final shake, the remnant intestine was removed from the solution and the crypt/villi units were quantified and pelleted.

The pelleted epithelium was re-suspended directly into hESC Matrigel (BD Bioscience, San Jose, CA) supplemented with 100 ngmL−1 recombinant mouse Noggin (Peprotech, Rocky Hill, NJ), 500 ngmL−1 recombinant human R-Spondin (R&D Systems, Minneapolis, MN), 50ngmL−1 recombinant mouse EGF (Life Technologies, Carlsbad, CA), 100 ngmL−1 recombinant human Wnt3a (R&D systems), 10 µM Y-27632 (Selleck), 10 µM SB202190 (Sigma), and 500 nM LY2157299 (Selleck). Between 50 and 200 crypt/villi units were plated in 50 uL of matrigel on a 48 well plate. After allowing the matrix to polymerize for 30 min at 37°C, each well was overlaid with 500 µL of Advanced DMEM/F12 containing the supplements 1× N-2 supplement (Life technologies), 1× B-27 supplement minus vitamin A (Life technologies), 1× Glutamax (Life Technologies), 100 µgmL−1 penicillin/streptomycin, 1 mM Hepes buffer (Life Technologies), and 1 mM N-Acetylcysteine. Growth factors were added to the media 48 hr after plating and every 72 hr following that. The entire volume of media was changed 72 hr following plating and every 72 hr after that. Every 1–2 weeks organoids were passaged at a 1∶5 ratio by mechanical dissociation, pelleting, and re-plating the pellet, into new Matrigel containing the growth supplements described above.

For histological studies, enteroids were fixed in a PBS solution containing 4% paraformaldehyde at room temperature for 20 min. Fixed enteroids were washed in a 30% sucrose solution and embedded in Optimal Cutting Temperature (OCT) media. Enteroids were cut into 5–8 µm sections and heat induced epitope retrieval was preformed when necessary by heating in reveal decloaker solution (Biocare Medical, Concord, CA) to 120°C for 30 sec and then 90°C for 10 sec inside a pressure cooker. Slides were allowed to cool to room temperature for 20 min prior to staining. Enteroids were permeabilized in a 0.3% Triton X-100 PBS solution for 20 min and then blocked in protein block solution (Dako, Carpinteria, CA) for 30 min. Primary antibodies, αSOX9, αMucin2, αsucrose isomaltase, and αPCNA, at the same dilutions previously described, were applied to the slides in antibody diluent (Dako) and incubated for 2 hr at room temperature. All secondary staining was preformed with Cy3 conjugated antibodies (Jackson ImmunoResearch, West Grove, PA) diluted 1∶500 in antibody diluent (Dako) incubated at room temperature for 45 min. Nuclei were marked with bisBenzimide H 33258 nuclear stain (Sigma/ Aldrich) diluted 1∶1000 in PBS and applied for 5 min at room temperature. Confocal images were obtained using a Zeis LSM 710 laser scanning microscope. The objective lenses used were X40 water and X63 oil with numerical apertures 1.1 and 1.4, respectively (C-Apochromat, Plan-Apochromat, Zeiss, Jena, Germany).

Results

Identification of cells of epithelial origin

To distinguish epithelial cells from those of mesenchymal and hematopoietic origin, we tested whether two candidate antibodies raised against mouse EpCAM (CD326) and human Villin would exclusively label pig epithelial cells. EpCAM is a pan-epithelial transmembrane protein that functions as a homotypic calcium-independent cell adhesion molecule [35]. EpCAM expression was observed in the basolateral membrane of all cells arranged along the luminal monolayer of the epithelial mucosa (Figure 1) [35]. In the small and large intestine, Villin expression is localized to the apical border of the intestinal epithelial cells due to its association with the microvillar actin filaments [36]. Villin expression demonstrated a gradient of increased staining intensity from the crypt toward the lumen as has been described in normal mammalian tissue (Figure 1) [36].

Figure 1. Markers to identify cells of epithelial origin.

Figure 1

Identification of intestinal cells of epithelial origin within the porcine small intestine and colon are shown. Immunostaining for EpCAM, a pan-epithelial transmembrane protein, demonstrated expression in the basolateral membrane of all cells in both the small intestine and colon arranged along the luminal monolayer of the epithelial mucosa. Immunostaining for Villin, a protein associated with the microvillar actin filaments, showed a gradient of expression localized to the apical border of small intestinal and colonic epithelial cells with increasing intensity in cells located closer to the lumen. All specific markers (red). Nuclei (blue). Scale bar 200 µm, inset scale bar 50 µm.

Markers of proliferation and apoptosis identify cells within each stage of the cell cycle

Assessing the proliferative capacity of IESCs and their progenitors is essential for monitoring regenerative responses in the small intestine and colon. Proliferating Cell Nuclear Antigen (PCNA) is accepted as a general proliferation marker and localized to the nucleus of the majority of cells constituting the crypt base in porcine tissue (Figure 2). Minichromosome Maintenance Complex 2 (MCM2) serves as a biomarker for cells that are peaking at G1-S phase [28]. The thymidine analogs BrdU or EdU are well established markers for cells in S-phase [29]. Both MCM2 and BrdU were localized within the nuclei of a subset of cells within the proliferative zone (Figure 2). Histone H3 is phosphorylated (pH3) at the end of prophase and represents a suitable marker for cells in G2-M-phase of the cell cycle. pH3 positive cells marked a minority of cells within all crypt bases consistent with the limited number of cells at this point in the cell cycle [30]. Immunostaining jejunal and colonic tissues for each of these proliferation markers demonstrates robust cross-reactivity with cells located in the proliferative zone of the crypt as has been demonstrated in mice (Figure 2) [28], [37], [38]. These validated antibodies for porcine gut tissue represent a comprehensive set of reagents for detailed study of the proliferative response in physiology, disease and injury induced regeneration.

Figure 2. Markers to assess proliferation and apoptosis.

Figure 2

Identification of proliferative cells in different stages of the cell cycle and those undergoing apoptosis in porcine small intestine and colon are shown. All proliferative markers localized to the nuclei of positive epithelial cells. Immunostaining for PCNA, a general marker for cellular proliferation, demonstrated the greatest number of positive cells compared to the other markers of proliferation. Immunostaining for MCM2, a marker of cells at the G1 stage of the cell cycle, was localized to a subpopulation of cells within the crypt base. Immunostaining for BrdU, a marker of cells within the S stage of the cell cycle, was also localized to a subpopulation of cells within the crypt base. Immunostaining for pH3, a marker for cells between the G2 – M stage of the cell cycle was similarly localized but to fewer cells. Immunostaining for cleaved caspase 3, an indicator of apoptosis, marked a few expressing cells near the villus tip within small intestine and the luminal surface of colon. All specific markers (red). Nuclei (blue) Scale bar 200 µm, inset scale bar 50 µm.

Interrogating apoptotic dynamics is equally important to understanding mechanisms underlying a regenerative response [39]. Caspase3 cleavage represents the execution phase of apoptosis [39]. The antibody against cleaved human caspase 3 (CASP3) marked few cells at the villus tip in porcine small intestine and colon where an apoptotic event known as ‘anoikis’ typically occurs (Figure 2) [26]. Rare cells at the base of the crypts were observed which is consistent with rare apoptotic incidences in physiologic renewal.

Identification of stem and progenitor cell populations

Next, we aimed to distinguish stem/progenitor cells from fully differentiated lineages. Recent evidence supports the presence of IESCs that exist in different states of proliferative capacity [40], [41]. Crypt-based columnar ‘active’ stem cells (CBCs) are located intercalated between Paneth cells in mice, are constantly dividing, and primarily responsible for the burden of homeostatic epithelial regeneration. Unfortunately, the commercially available antibodies used to detect the CBC population, LGR5, OLFM4, and CD24 did not demonstrate cross reactivity with active CBC stem cells in porcine intestinal tissue (data not shown; Table 2). However, antibodies raised against SOX9, a member of the SRY-family of transcription factors primarily expressed in CBCs and transit-amplifying progenitor cells, demonstrated the ability to detect proliferating cells in the base of the small intestine and colonic crypts with distinct localization to the nucleus of positive cells (Figure 3) [31], [42], [43].

Table 2. Non Functional Antibodies.

Protein Company Catalog # Host Species
IESC
LGR5 Santa Cruz sc-68580 Goat
LGR5 Origene TA301323 Rabbit
SOX4 Santa Cruz sc-17326 Goat
SOX17 Santa Cruz sc-17355 Goat
DCAMKL1 Abgent AP7219b Rabbit
DCAMKL1 Abcam 37994 Rabbit
MSI1 Millipore AB5977 Rabbit
OLFM4 Abcam AB85046 Rabbit
OLFM4/GC-1 Santa Cruz Sc-84274 Rabbit
CD24 BD Pharmingen 557436 Rat
CD24 Thermoscientific 1279 Mouse
Progenitor
NEURO D Santa Cruz sc-1084 Goat
HES1 Santa Cruz sc-13844 Goat
HES1 Millipore D153-3 Rabbit
NSUN1 Santa Cruz sc-83439 Goat
NOTCH1 Santa Cruz sc-6014 Rabbit
Proliferative
Ki 67 Santa Cruz sc-7846 Goat
cMYC Santa Cruz sc-764 Rabbit
Cyclin D1 Diagnostic Biosystems RMAB003 Rabbit
Paneth
Lysozyme Diagnostic Biosystems RP028 Rabbit
Lysozyme Santa Cruz sc-27598 Goat
cKIT (CD117) MBL 566 Rabbit
Enteroendocrine
Synaptophysin Abcam ab52636 Rabbit

Figure 3. Markers to identify stem, progenitor, and transit amplifying cells.

Figure 3

Identification of stem, progenitor, and transit amplifying cells in porcine small intestine and colon are shown. Immunostaining for SOX9, a member of the SRY-family of transcription factors that is primarily expressed in CBC cells and transit-amplifying progenitor cells, is localized to the nuclei of all cells within the crypt base of both the small intestine and colon. Immunostaining for SOX9 demonstrates colocalization with the proliferative cells (PCNA+) at the crypt base. Immunostaining for HOPX, an atypical homeodomain containing protein, demonstrated marking of cells consistent in location and numbers with a ‘reserve’ IESC population. All specific markers (red or green). Nuclei (blue). Scale bar 200 µm, inset scale bar 50 µm.

Another putative stem cell population, termed ‘the +4 stem cells’, are a slower dividing ‘reserve’ or facultative stem cell that primarily reside above the Paneth cell compartment in mice and humans [41], [44]. In order to identify a putative +4 stem cell population, an antibody against human HOPX, an atypical homeodomain containing protein, was tested. Immunostaining for HOPX showed cross reactivity to cells in pig intestinal tissue with expression pattern restricted to the ‘+4’ stem cell zone consistent with what has been observed in mice (Figure 3) [32].

Identification of absorptive cell lineage

Enterocytes function to absorb nutrients, electrolytes and water and are the predominant cell type within the intestinal mucosa [33]. The histologic identification of this cell lineage is used to assess whether appropriate cellular differentiation is occurring during a regenerative response [45], [46]. Immunostaining for the digestive enzymes, sucrase isomaltase (SIM) and carbonic anhydrase II (CAII) clearly demonstrates localization to the apical brush-border of the absorptive enterocytes in the small and large intestine, respectively. [47], [48]. There was no positive immunostaining of SIM in the colon or CAII in the small intestine indicating these antibodies are suitable to differentially distinguish between these two absorptive cell types (Figure 4).

Figure 4. Markers to identify the absorptive cell lineage.

Figure 4

Identification of absorptive enterocytes in porcine small intestine and colon are shown. Immunostaining for enterocytes demonstrates sucrase isomaltase, a digestive enzyme, marking the apical brush- border of cells in the small intestine. Carbonic anhydrase, a digestive enzyme, positively identified absorptive cells in the colon with staining localized to the apical brush- border of these cells. All specific markers (red). Nuclei (blue). Scale bar 200 µm, inset scale bar 50 µm.

Identification of secretory cell lineage

In mice and humans three primary secretory lineages exist, enteroendocrine cells, goblet cells and paneth cells. Enteroendocrine cells represent a minor population of cells that secrete various hormones that regulate gut physiology and appetite control [49]. Chromogranin A (CgA) is an acidic glycoprotein that localizes within secretory granules of nearly all enteroendocrine cells and is considered a general marker for all enteroendocrine cell subtypes [50]. Immunostaining for CgA localized to the cytoplasm of a minority of cells throughout the length of the small intestine and colon, consistent in morphology with enteroendocrine cells found in other animal species [31], [51] (Figure 5).

Figure 5. Markers to identify the secretory cell lineage.

Figure 5

Identification of secretory cells in porcine small intestine and colon are shown. Immunostaining for enteroendocrine cells, the hormone secreting cells important to gut homeostasis, using antibodies against CgA, SST, GLP-1 and GAST, demonstrated staining within the cytoplasm of positive cells of the small intestine. A similar pattern of staining was identified in the colon for CgA, SST and GLP-1. All specific markers (red). Nuclei (blue). Scale bar 200 µm, inset scale bar 50 µm.

Subtypes of enteroendocrine cells could also be identified in pig intestinal epithelium. Gastrin (GAST) is a hormone secreted by G cells in the stomach and duodenum, and it functions as both a mucosal growth factor and stimulator of mast and parietal cells [49]. An antibody against human Gastrin (GAST) identified a minority of cells in the duodenum while no immunostaining was observed along other segments of the small or large intestine, an observation consistent with the expression pattern of GAST observed in humans [49] (Figure 5). Somatostatin (SST) is a hormone secreted by delta cells throughout the length of the intestine and functions to block the release of many gut hormones ultimately affecting epithelial transport and intestinal motility [49], [52]. SST-positive cells were observed intermittently in all segments of the porcine intestine (Figure 5). The main role of glucagon-like peptide 1 (GLP-1) is to delay gastric emptying and signal post prandial satiety and that of glucagon-like peptide 2 (GLP-2) is to stimulate mucosal enterocyte proliferation [53]. Reactivity to the glucagon antibody, with cytoplasmic localization, was observed within the enteroendocrine cells along the proximal distal axis of the small intestine (Figure 5) consistent with that observed in mice and humans [53], [54].

Secretory goblet cells produce mucins that are integral to intestinal physiology by providing protection of the epithelial surface as well as aiding in absorption [55]. Immunostaining for Mucin 2 (MUC2) exclusively marked mucous-producing cells along the entire length of small and large intestine as well as the crypt-villus axis (Figure 6). Positive staining was localized to the cytoplasm of positive cells and within the luminal surface which is the expected location of mucinous secretions. Ulex europaeous agglutinin-1 (UEA-1) is a lectin that specifically binds to alpha-linked fructose receptors located on cell surface glycoproteins and glycolipids and is used to detect both goblet and Paneth cells in mice [56]. UEA-1 bound to the mucinous secretions of goblet cells in porcine small and large intestine (Figure 6). Besides marking goblet cells in fixed tissue sections, UAE-1 is likely suitable for fluorescence activated cell sorting of live cells [37].

Figure 6. Markers to identify goblet cells.

Figure 6

Identification of goblet cells in porcine small intestine and colon are shown. Goblet cells, the mucus producing cells, were identified by immunostaining for MUC2, a component of mucin, and UEA-1, a lectin that specifically binds to alpha-linked fructose receptors. The mucinous secretions of multiple cells in both the small intestine and colon were positively identified. All specific markers (red). Nuclei (blue). Scale bar 200 µm, inset scale bar 50 µm.

The existence of the Paneth cell in the pig remains disputed [57], [58]. No eosin or toluidine blue staining, which typically marks apically located granules in Paneth cells, was identified in the crypt base of porcine small intestine (data not shown). In mice lysozyme expression is a biomarker for Paneth cells [59], [60]. Lysozyme staining was not observed in the epithelium of porcine small intestine despite the use of multiple anti-lysozyme antibodies (data not shown; Table 2).

TEM characterization of porcine crypt-based cells

Transmission electron microscopy allows for the morphological identification of cell lineage by the presence or absence of sub-cellular features [6], [33], [61][63]. Comparative analysis of crypt-based cells from various organisms has enabled the characterization of cell types that are consistent with particular lineages [6], [33]. A complete description of the pig small intestine and colon, to the best of our knowledge, has not been previously described. At least two distinct cell types were distinguishable in the crypt base of the pig small intestine and colon (Figure 7). Multiple irregularly shaped, small, columnar cells with basally located nuclei and scarce cytoplasm, consistent in appearance with CBC cells of mice and humans [33], [64], were interspersed between large pyramidal shaped cells with large supranuclear clear mucoid vesicles and small electron dense bodies (Figure 7). The appearance of these large mucoid filled cells was not entirely consistent with the accepted morphological features of Paneth cells in other mammalian species [63], [65]. The goblet cell within the small intestine and colon of the pig possessed small basally located nuclei that were notably distended apically with mucinous globules consistent with the accepted ultrastructural appearance in mammalian intestinal tissue (Figure 7) [61], [66]. The enteroendocrine cells of the pig intestine demonstrated a narrow apex and wide base with many small, spheroidal, electron dense granules in the infranuclear region as is classically described in mammals (Figure 7) [62], [66], [67]. The mature absorptive enterocytes of the pig intestine were clearly distinguishable as columnar shaped cells with centrally located nuclei. Other key features of these cells include multiple organelles and a lack of secretory granules within the cytoplasm and a position closer to the gut lumen in both the small intestine and colon, as has been described in other mammals (Figure 7) [33], [66]. These electron micrographs of the porcine crypt base represents a foundation for morphologic description of cells in normal, injury and disease states.

Figure 7. Transmission electron microscopic epithelial characterization.

Figure 7

The ultrastructural appearance and characterization of porcine small intestine and colonic epithelial cells are shown. All cell types were morphologically distinguishable. Crypt base columnar stem cells, goblet cells, enteroendocrine cells, and absorptive enterocytes are all marked with asterisks. ‘L’ indicates lumen. Small Intestinal images, scale bar 2 µm. Colon images, scale bar 5 µm.

Assessment of gene expression in stem/progenitor and differentiated cell lineages

Measuring gene expression is essential to understanding mechanisms of injury, disease and the stem cell-driven regeneration. Because qPCR primer sets to detect target gene expression in pig are limited, we designed and validated primers to genetic biomarkers of stem/progenitor cells, differentiated cell lineages, and important signal transduction pathways involved in regeneration [38], [44], [68], [69]. Twenty one candidate PCR primers were designed and six were previously described [27], [70], [71] (Table 3). Amplification of cDNA generated from total intestinal RNA demonstrated expression of Wnt3a+ and Lgr5+, which are important regulators of IESC maintenance [59], [59,72]. Genes important for Notch pathway regulation, Atoh1+, Dll4+, and Hes1+, were amplified from epithelial-derived cDNA. These genes are critical for appropriate cell differentiation and fate and important to interrogate in regeneration [38]. ‘Active’ stem cell markers, Olfm4+, Ascl2+, Sox9+, CD24+, were used to monitor stem cell renewal and maintenance. Hallmark genetic biomarkers for differentiated lineages were detected by amplification of Muc2+ and Itf+ (goblet cells), CgA+ and Cck+ (enteroendocrine cells), and Sglt1+ and L-Fabp+ (absorptive enterocytes) [43], [73][75]. Single amplicons of the appropriate size were verified by gel electrophoresis and DNA sequencing of all amplicons validated target gene amplification. Primers efficiencies were calculated using the equation, Efficiency  = 10∧(−1/slope) –1 and demonstrated >92% efficiency (Table 3). Under the conditions described, no primer-dimers were observed.

Table 3. Primers designed for gene expression in porcine intestine.

Target Sequences of primers (5′ to 3′) Annealing Temp(°C) Product Size Reference
House Keeping Genes
Gapdh ATCCTGGGCTACACTGAGGAC AAGTGGTCGTTGAGGGCAATG 60
Gusb TAACAAGCACGAGGATGCAG TCCTCTGCGTAGGGGTAGTG 60 129 Author
18S TGGAGCGATTTGTCTGGTTA ACGCTGAGCCAGTCAGTGTA 60 200 [71]
IESC
Lgr5 CCTTGGCCCTGAACAAAATA ATTTCTTTCCCAGGGAGTGG 60 110 Author
Olfm4 GTCAGCAAACCGGCTATTGT TGCCTTGGCCATAGGAAATA 60 226 Author
Sox9 CGGTTCGAGCAAGAATAAGC GTAATCCGGGTGGTCCTTCT 60 229 Author
Ascl2 GAGCTGCTCGACTTCTCCAG TTCCACACTAGCCCTTGGTC 60 204 Author
CD24 TAAGAGCCAGCGGTCCTCTA GACCGAGAGCACGAAGAGAC 62 283 Author
+4 Stem Cells/Quiescent
Bmi1 TCATTGATGCCACAACCATT TGAAAAGCCCCGGAACTAAT 60 189 Author
Proliferative Cells
Pcna TACGCTAAGGGCAGAAGATAATGCTGAGATCTCGGCATATACGTG 60 192 [27]
Atoh CACGGGCTGAACCACGCCTT GGTACCCGCGCTTGCTTCGT 60 234 Author
Hes1 ATTCCTCGTCCCCGGTGGCT TGCTTAGCGCGGCCGTCATC 62 279 Author
Goblet Cells
Muc2 GGCTGCTCATTGAGAGGAGT ATGTTCCCGAACTCCAAGG 60 249 Author
Itf TCGGTTCCCCAGAACCTGCCC CGGGGATGCTGGAGTCGAAGC 60 220 Author
Enteroendocrine Cells
CgA GACCTCGCTCTCCAAGGAGCCA TGTGCGCCTGGGCGTTTCTT 60 332 Author
Cck CAAAAGGTAGACGGCGAGTC GCGGGGTCTTCTAGGAGGTA 60 217 Author
Enterocytes
Sglt1 GCAGCTGTCTTCCTACTTGC GCAAACTCGGTAATCATACGG 60 113
L-Fabp CCGGCAAATACCAAGTACAGAGCCCCTTCTCCCCAGTCAGGGTCTCC 60 225 Author
Growth Factors and Signaling Molecules
Tgfα CAGCTGTGGTGTCCCATTTT TAATGGCCTGCTTCTTCTGG 62 189 Author
Egf TGGCAGATGCTGGAATATCA AAGGCGCTTAAGAGAACACG 60 262 Author
Dll4 TCATCATCGAAGCTTGGCAC GCGCTTCTTGCATAGACGTG 60 224 Author
Wnt3a GCGACTTCCTCAAGGACAAG GGTCACGTGTACCGAAGGAT 60 201 Author
Wnt11 CGTGTGCTATGGCATCAAGT TCTCTCCAGGTCAAGCAGGT 60 259 Author
Lyz GGTCTATGATCGGTGCGAGT AACTGCTTTGGGTGTCTTGC 62 220 Author
pBD1 ACCGCCTCCTCCTTGTATTC GGAGCAGCTTCTGAGCCATA 60 233 Author
pBD2 ATGAGGGCCCTCTGCTTGCT ATACTTCACTTGGCCTGTGTGTCC 60 259 [70]
Apoptosis
Casp3 ACCCAAACTTTTCATAATTCA ACCAGGTGCTGTAGAATATGC 60 143 [27]

In vitro culture of porcine crypts

Long-term culture of intestinal epithelial stem cells in mice and humans has only recently been accomplished and has revolutionized the ability to conduct detailed mechanistic studies in a highly controlled manner [38], [76][78]. Pig crypts isolated from jejunal tissue were introduced into a modified 3-dimensional (3-D) culture environment similar to the culture conditions that support growth of mouse and human enteroids [42], [76][79]. Within 24 hours of plating whole pig crypts in matrigel with defined medium, enterosheres formed (Figure 8, day 2) [80]. These structures persisted until day 4 and then began to convert into enteroids that possessed columnar epithelial cells and primitive crypt buds (Figure 8, day 4). Mature crypt buds developed by day 14 and by day 21 enteroids were fully formed (Figure 8, day 14 and 21). Enteroid cross sections demonstrated the presence of SOX9+ stem/progenitor cell populations, PCNA+ zones of proliferation, MUC2+ goblet cells, CgA+ enteroendocrine cells, and SIM+ absorptive enterocytes (Figure 9). Fully developed enteroids were allowed to persist in culture for two weeks at which point they were passaged. To date, enteroids have been passaged 8 times representing a total of 4.5 months in culture. There has been no apparent decrease in enteroid formation over this time.

Figure 8. In vitro culture of porcine crypts.

Figure 8

The in vitro isolation, growth and maintenance of enteroids derived from porcine intestinal crypts are shown. On the day of collection (day 0) crypts maintain their morphologic appearance. As the enteroids develop they become enterospheres (day 2) and progressively enlarge and form complex structures with a pseudolumen and crypt-like structures (days 4, 8, 14, 21). Scale Bar 100 µm.

Figure 9. Markers to identify cell lineages within in vitro cultures.

Figure 9

The identification of specific cell lineages within in vitro cultures of porcine crypts is shown. The existence of stem/progenitor and differentiated lineages were confirmed in enteroids utilizing the established genetic biomarkers for cell lineage identification: anti-SOX9 (stem/progenitor), anti-PCNA (proliferation), anti-CgA (enteroendocrine), anti-MUC2 (goblet) and anti-sucrase isomaltase (absorptive enterocyte) antibodies. All specific markers (red). Nuclei, blue. Scale Bar 50 µm, inset scale bar 10 µm.

Discussion

A recent NIH symposium entitled “Improving Animal Models for Regenerative Medicine” focused on the development of large animal models for the study of human disease [81]. The motivation for the symposium was the persistent failure in translating murine models to clinical treatments [81]. The utility of the pig as a large animal model has been well-documented for many body systems [15][21], [82][88]; and the similarities between the pig and human gastrointestinal system position the pig as a promising species for animal models of gastrointestinal disease. Seminal advances made in murine intestinal stem cell biology now position investigators to answer clinically relevant problems from the perspective of stem cell-driven epithelial regeneration. Data presented in this study lay the foundation for developing the pig as a large and physiologically relevant animal model for these studies. This study identifies, develops and validates a range of genetic biomarkers and crypt culture strategies that will enable investigators to assess stem cell maintenance and potency in both the small and large intestine of pig models of physiology, injury and disease.

Few studies use commercially available antibodies on porcine intestinal tissue to assess cell lineage allocation, thus limiting the ability to effectively monitor and analyze epithelial regenerative responses [10], [25][27], [89], [90]. To address this problem, we identified a comprehensive set of commercially available antibodies that would cross-react with target pig proteins to enable detection of stem/progenitor and post-mitotic lineages. The ability to specifically observe epithelial dynamics during physiology and disease is critical to understanding and quantifying regenerative processes and therapeutic interventions [10]. Appropriate designation of EpCAM expressing cells, for example, can offer insight into epithelial cell-cell adhesion, migration, signaling, differentiation and proliferation since it plays a key role in these cellular functions [35]. Additionally, assessing the proliferative capacity of IESCs and their progenitors is essential for monitoring regenerative responses in the small intestine and colon. Detailed analysis of cell cycle progression during injury and disease states could yield important information pertaining to repair mechanisms. The maintenance of epithelial barrier function depends on the tightly controlled balance between cellular proliferation, differentiation and apoptosis. Monitoring the phenotypic changes resulting from injury or in genetically modified animals can shed light into critical homeostatic pathways. These pathways can now be monitored in pig models utilizing the biomarkers for PCNA, MCM2, BrdU, pH3 and CASP3.

Identification of stem and progenitor cell populations has proven critical to deciphering important cellular pathways as well as the impact and response of these cells to injury. In mice, ‘active’ IESCs are marked by Lgr5, Olfm4, Ascl2, Sox9 [31], [43], [59], [60], [73], [74], [91], [92]. Unfortunately, of the commercially available antibodies for CBCs tested, only SOX9 demonstrated positive staining. Sox9 is a member of the SRY-family of transcription factors that is primarily expressed in crypt-based columnar stem cells and transit-amplifying progenitor cells [31], [42], [43]. Enteroendocrine and Tuft cells also express very high levels of Sox9 and recent evidence suggests that the Sox9 high population has ‘reserve’ IESC capacity [31], [42][44], [75]. Slower dividing ‘reserve’ or facultative stem cells primarily reside above the Paneth cell compartment in mice and humans [41], [44]. These have been historically termed ‘the +4 stem cells’ which denotes the cell position in the crypt base where they most likely exist [93]. As the name suggests, facultative IESCs appear to respond to injury stimulus to re-enter an active state to regenerate the epithelium [44], [69], [94]. To some extent, the reserve IESC population is marked by Bmi1, Tert, Hopx, and Lrig1 in mice [37], [95][101]. Immunostaining for HOPX will enable future studies utilizing porcine models to evaluate the role of these putative ‘reserve’ IECSs during and following intestinal injury.

The ability to observe and quantify fully differentiated cells is critical to understanding the dynamics of epithelial regeneration in normal homeostasis, injury, and repair. CgA was used as a general marker of enteroendocrine cells but multiple sub-types were also characterized. The hormones produced by all of the enteroendocrine cells are integral to crypt cell physiology. Proglucagon, for example, is produced and cleaved within the L-type enteroendocrine cells into glucagon-like peptide-1 (GLP-1) and glucagon-like peptide-2 (GLP-2) [54]. Interestingly, glucagon-like peptides demonstrate immunoreactivity to antibodies against glucagon, the product of cleaved proglucagon in the pancreas [54]. The potential therapeutic benefits of both GLP-1 and GLP-2 are of interest for multiple important human diseases. GLP-1 is integral to both signaling satiety and in glucose homeostasis. GLP-1 based treatments are now well established in the management of type 2 diabetes and have been proposed for the treatment of obesity [102]. Research into the therapeutic benefits of GLP-2 administration to hasten epithelial proliferation with direct stimulatory effects on the stem cell population following intestinal resection have also been studied [12], [103][105]. The ability to clearly identify GLP-1 and GLP-2 producing cells may then prove integral in pig models that study weight management, diabetes and short bowel syndrome [12], [102], [103], [106].

Electron microscopy supported the immunohistochemical findings on porcine small and large bowel showing clear ultrastructural characteristics of lineage states along the crypt villus axis. Electron microscopy provided morphological evidence suitable for identification of cells consistent with CBC stem cells, goblet cells, enteroendocrine cells and absorptive enterocytes. TEM studies have and will continue to contribute to understanding the ultrastructural cellular changes that occur during disease and repair processes as well as following signaling pathway manipulation that may not be possible with immunohistochemical studies [95], [107], [108]. TEM has been utilized, for example, to visualize invasion of intestinal epithelium by viral particles and detailed evidence of the impaired structural integrity of epithelial tight junctions in disease [108][110].

Quantitative gene expression analysis is highly sensitive and contributes to a more complete characterization of intestinal epithelium in the pig. In this study, the PCR primers were specifically designed to amplify target genes currently used as molecular signatures for each cell type and important signaling molecules known to regulate intestinal homeostasis. Interpreting gene expression dynamics during and following intestinal injury can give insight into the cell populations, CBCs (Lgr5+, Olfm4+, Sox9+, Ascl2+, CD24+) versus ‘reserve’ stem cells (Bmi1+), that are compromised or stimulated in the process [44], [69], [95]. Additionally, the impact on stem cell homeostasis (Wnt3a+), proliferative capacity (PCNA+), and cell fate determination (Atoh+, Hes1+) can be evaluated to interpret epithelial regenerative capacity [44], [69], [111]. Ultimately, by evaluating the specific post-mitotic cell populations, absorptive enterocyte (Sglt1+, L-Fabp+) or specific secretory cells (Muc2+, Itf+, CgA+, Cck+) that are sensitive to or upregulated in response to injury, potential therapeutics aimed at signal pathway manipulation can be pursued [38], [75], [112], [113]. Having defined qPCR primers allows for thorough and reliable interpretation of cellular pathway dynamics, and therefore, insight into mechanistic processes controlling epithelial regeneration.

An intriguing observation in cross species comparison of the small intestine epithelium is the presence of the Paneth cell lineage in some species and the absence in others. Paneth cells are long-lived post-mitotic cells that reside in the base of the small intestinal crypts in some species. In mice, Paneth cells have been implicated in serving as a ‘nurse’ cell for the CBC stem cells by secreting WNTs and presenting NOTCH-ligands [38], [59], [60]. In the colon, evidence indicates that a c-KIT+ MUC2+ cell may serve as an analogous counterpart to the Paneth cell in the colon [114]. The existence of Paneth cells in pigs is still debated [57], [58]. Morphologically, Paneth cells can be identified by the ultrastructural presence of an elongated flattened nucleus, large cytoplasm and secretory granules [63], [65]. In our porcine studies, TEM and immunostaining do not support the presence of a bona fide Paneth cell; however, our study presents data that is consistent with the interpretation that a Paneth cell equivalent, similar to that of the mouse colon, may be present in pig small intestinal crypts.

TEM and morphometric analyses presented in our study indicate that at least two different cell types reside within the crypt base. A small columnar shaped cell with a basally located nucleus and sparse cytoplasm seems consistent with the accepted ultrastructural appearance of the CBCs in other species. Interspersed between these cells is a larger cell type with electron dense supranuclear secretory vesicles. Many of these cells also contain clear, mucoid in appearance, apically located vesicles. Interestingly, the ultrastructural appearance of the secretory granules vary in size and number as well as electron density between those species accepted as having Paneth cells [65]. Post-mitotic cells (PCNA and MCM2 negative) are also present at the crypt base in the pig. These cells appear to be Sox9+ and Muc2+, and UEA-1+, which is consistent with the Paneth-like cells identified in mouse colonic crypts and marked by c-KIT [114]. Unfortunately, we were unable to verify c-KIT staining in these cells due to the lack of cross-reactivity with the c-KIT antibodies tested. These data point to the need for more detailed analysis of gene expression to determine if they produce functionally relevant mitogens and morphogens similar to Paneth or Paneth-like cells in the mouse small intestine and colon.

Besides enabling detailed mechanistic studies in vitro, long-term crypt culture from the pig small intestine represents a significant advancement toward developing tissue-engineering strategies and stem cell-based therapies. Organoid units from primary small intestine have been placed on biodegradable scaffold tubes and then implanted into the omentum of an autologous host [25]. The engineered tissue demonstrated morphological characteristics of small bowel 7-weeks post implantation. While these studies used biopsied samples derived from resected tissue, it is likely that a therapeutic mass of tissue would be required to be clinically relevant. The culture method developed in this study will enable a small number of crypts, perhaps from a biopsy, to be expanded ex vivo to increase the mass of epithelium required to test therapeutic strategies for tissue replacement. Detection of successful and functional tissue replacement is fundamental to monitoring outcomes of these new approaches to treat disease and injury to the intestinal epithelium. This new long-term crypt culture model also represents a significant advancement toward development of pharmaceutical screening modalities, stem cell therapy models, and tissue replacement strategies that can all be tested in a translationally relevant context. The comprehensive set of reagents identified, developed and validated will serve as a foundation for using the pig as a translational model to study stem cell-driven regeneration of the intestinal epithelium.

Acknowledgments

The authors gratefully acknowledge Dr. Jody Gookin from the Department of Clinical Sciences at NCSU-CVM for her assistance with the development of the in vitro culture of porcine crypts as well as donation of tissue for BrdU staining. We thank Odessa Marks, Seywon Koh, Jaewook Chung and Ling Guo for their assistance with RTqPCR and Dr. Victoria Newton for her assistance with immunofluorescence. We also thank Wendy Savage of the Education Media & Design department and Dr. Jeanette Shipley-Phillips of the Laboratory for Advanced Electron and Light Optical Methods (LAELOM) at NCSU.

Funding Statement

This work was supported by the National Center for Research Resources and the National Center for Advancing Translational Sciences, National Institutes of Health, through Grant Award Number UL1TR000083 (STM/JP). Additional support provided by R01DK091427 (STM), R03DK089126 (STM), NIH/NCSU Comparative Medicine and Translational Research Training Program (CMTRTP) T32RR024394. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Leblond CP, Stevens CE (1948) The constant renewal of the intestinal epithelium in the albino rat. Anat Rec 100: 357–377. [DOI] [PubMed] [Google Scholar]
  • 2. Peery AF, Dellon ES, Lund J, Crockett SD, McGowan CE, et al. (2012) Burden of gastrointestinal disease in the united states: 2012 update. Gastroenterology 143: 1179–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Rizk P, Barker N (2012) Gut stem cells in tissue renewal and disease: Methods, markers, and myths. Wiley Interdiscip Rev Syst Biol Med 4: 475–496. [DOI] [PubMed] [Google Scholar]
  • 4. Blikslager AT, Moeser AJ, Gookin JL, Jones SL, Odle J (2007) Restoration of barrier function in injured intestinal mucosa. Physiol Rev 87: 545–564. [DOI] [PubMed] [Google Scholar]
  • 5. Lichtenstein GR, Rutgeerts P (2010) Importance of mucosal healing in ulcerative colitis. Inflamm Bowel Dis 16: 338–346. [DOI] [PubMed] [Google Scholar]
  • 6. Cheng H, Leblond CP (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. V. unitarian theory of the origin of the four epithelial cell types. Am J Anat 141: 537–561. [DOI] [PubMed] [Google Scholar]
  • 7. Kararli TT (1995) Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans and commonly used laboratory animals. Biopharm Drug Dispos 16: 351–380. [DOI] [PubMed] [Google Scholar]
  • 8. Nejdfors P, Ekelund M, Jeppsson B, Westrom BR (2000) Mucosal in vitro permeability in the intestinal tract of the pig, the rat, and man: Species- and region-related differences. Scand J Gastroenterol 35: 501–507. [DOI] [PubMed] [Google Scholar]
  • 9. Patterson JK, Lei XG, Miller DD (2008) The pig as an experimental model for elucidating the mechanisms governing dietary influence on mineral absorption. Exp Biol Med 233: 651–664. [DOI] [PubMed] [Google Scholar]
  • 10. Pereira-Fantini PM, Thomas SL, Wilson G, Taylor RG, Sourial M, et al. (2011) Short- and long-term effects of small bowel resection: A unique histological study in a piglet model of short bowel syndrome. Histochem Cell Biol 135: 195–202. [DOI] [PubMed] [Google Scholar]
  • 11. Nagy ES, Paris MC, Taylor RG, Fuller PJ, Sourial M, et al. (2004) Colostrum protein concentrate enhances intestinal adaptation after massive small bowel resection in juvenile pigs. J Pediatr Gastroenterol Nutr 39: 487–492. [DOI] [PubMed] [Google Scholar]
  • 12. Pereira-Fantini PM, Nagy ES, Thomas SL, Taylor RG, Sourial M, et al. (2008) GLP-2 administration results in increased proliferation but paradoxically an adverse outcome in a juvenile piglet model of short bowel syndrome. J Pediatr Gastroenterol Nutr 46: 20–28. [DOI] [PubMed] [Google Scholar]
  • 13. Pereira-Fantini PM, Thomas SL, Taylor RG, Nagy E, Sourial M, et al. (2008) Colostrum supplementation restores insulin-like growth factor -1 levels and alters muscle morphology following massive small bowel resection. JPEN J Parenter Enteral Nutr 32: 266–275. [DOI] [PubMed] [Google Scholar]
  • 14. Bines JE, Taylor RG, Justice F, Paris MC, Sourial M, et al. (2002) Influence of diet complexity on intestinal adaptation following massive small bowel resection in a preclinical model. J Gastroenterol Hepatol 17: 1170–1179. [DOI] [PubMed] [Google Scholar]
  • 15. Argenzio RA, Armstrong M, Blikslager A, Rhoads JM (1997) Peptide YY inhibits intestinal cl- secretion in experimental porcine cryptosporidiosis through a prostaglandin-activated neural pathway. J Pharmacol Exp Ther 283: 692–697. [PubMed] [Google Scholar]
  • 16. Moeser AJ, Klok CV, Ryan KA, Wooten JG, Little D, et al. (2007) Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am J Physiol Gastrointest Liver Physiol 292: G173–81. [DOI] [PubMed] [Google Scholar]
  • 17. Moeser AJ, Ryan KA, Nighot PK, Blikslager AT (2007) Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am J Physiol Gastrointest Liver Physiol 293: G413–21. [DOI] [PubMed] [Google Scholar]
  • 18. Sangild PT, Siggers RH, Schmidt M, Elnif J, Bjornvad CR, et al. (2006) Diet- and colonization-dependent intestinal dysfunction predisposes to necrotizing enterocolitis in preterm pigs. Gastroenterology 130: 1776–1792. [DOI] [PubMed] [Google Scholar]
  • 19. Cilieborg MS, Thymann T, Siggers R, Boye M, Bering SB, et al. (2011) The incidence of necrotizing enterocolitis is increased following probiotic administration to preterm pigs. J Nutr 141: 223–230. [DOI] [PubMed] [Google Scholar]
  • 20. Blikslager AT, Roberts MC, Rhoads JM, Argenzio RA (1997) Is reperfusion injury an important cause of mucosal damage after porcine intestinal ischemia? Surgery 121: 526–534. [DOI] [PubMed] [Google Scholar]
  • 21. Block T, Isaksson HS, Acosta S, Bjorck M, Brodin D, et al. (2011) Altered mRNA expression due to acute mesenteric ischaemia in a porcine model. Eur J Vasc Endovasc Surg 41: 281–287. [DOI] [PubMed] [Google Scholar]
  • 22. Schwartz CA, Haage P, Hohl C (2012) Experimental early detection of acute mesenteric ischemia with functional MRI (DWI) and parallel imaging. Rofo 184: 520–526. [DOI] [PubMed] [Google Scholar]
  • 23. Abu-Elmagd KM, Kosmach-Park B, Costa G, Zenati M, Martin L, et al. (2012) Long-term survival, nutritional autonomy, and quality of life after intestinal and multivisceral transplantation. Ann Surg 256: 494–508. [DOI] [PubMed] [Google Scholar]
  • 24. Gookin JL, Chiang S, Allen J, Armstrong MU, Stauffer SH, et al. (2006) NF-kappaB-mediated expression of iNOS promotes epithelial defense against infection by cryptosporidium parvum in neonatal piglets. Am J Physiol Gastrointest Liver Physiol 290: G164–74. [DOI] [PubMed] [Google Scholar]
  • 25. Sala FG, Kunisaki SM, Ochoa ER, Vacanti J, Grikscheit TC (2009) Tissue-engineered small intestine and stomach form from autologous tissue in a preclinical large animal model. J Surg Res 156: 205–212. [DOI] [PubMed] [Google Scholar]
  • 26. Foster DM, Stauffer SH, Stone MR, Gookin JL (2012) Proteasome inhibition of pathologic shedding of enterocytes to defend barrier function requires X-linked inhibitor of apoptosis protein and nuclear factor kappaB. Gastroenterology 143: 133–44. [DOI] [PubMed] [Google Scholar]
  • 27. Willing BP, Van Kessel AG (2007) Enterocyte proliferation and apoptosis in the caudal small intestine is influenced by the composition of colonizing commensal bacteria in the neonatal gnotobiotic pig. J Anim Sci 85: 3256–3266. [DOI] [PubMed] [Google Scholar]
  • 28. Pruitt SC, Freeland A, Kudla A (2010) Cell cycle heterogeneity in the small intestinal crypt and maintenance of genome integrity. Stem Cells 28: 1250–1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Potten CS, O'Shea JA, Farrell CL, Rex K, Booth C (2001) The effects of repeated doses of keratinocyte growth factor on cell proliferation in the cellular hierarchy of the crypts of the murine small intestine. Cell Growth Differ 12: 265–275. [PubMed] [Google Scholar]
  • 30. Fox RG, Magness S, Kujoth GC, Prolla TA, Maeda N (2012) Mitochondrial DNA polymerase editing mutation, PolgD257A, disturbs stem-progenitor cell cycling in the small intestine and restricts excess fat absorption. Am J Physiol Gastrointest Liver Physiol 302: G914–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Formeister EJ, Sionas AL, Lorance DK, Barkley CL, Lee GH, et al. (2009) Distinct SOX9 levels differentially mark stem/progenitor populations and enteroendocrine cells of the small intestine epithelium. Am J Physiol Gastrointest Liver Physiol 296: G1108–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Takeda N, Jain R, LeBoeuf MR, Wang Q, Lu MM, et al. (2011) Interconversion between intestinal stem cell populations in distinct niches. Science 334: 1420–1424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Cheng H, Leblond CP (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. I. columnar cell. Am J Anat 141: 461–479. [DOI] [PubMed] [Google Scholar]
  • 34.Dykstra MJ, Reuss LE (2003) Biological electron microscopy: Theory, techniques, and troubleshooting. New York: Kluwer Academic/Plenum Publishers.
  • 35. Trzpis M, McLaughlin PM, de Leij LM, Harmsen MC (2007) Epithelial cell adhesion molecule: More than a carcinoma marker and adhesion molecule. Am J Pathol 171: 386–395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. West AB, Isaac CA, Carboni JM, Morrow JS, Mooseker MS, et al. (1988) Localization of villin, a cytoskeletal protein specific to microvilli, in human ileum and colon and in colonic neoplasms. Gastroenterology 94: 343–352. [DOI] [PubMed] [Google Scholar]
  • 37. Wong VW, Stange DE, Page ME, Buczacki S, Wabik A, et al. (2012) Lrig1 controls intestinal stem-cell homeostasis by negative regulation of ErbB signalling. Nat Cell Biol 14: 401–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. VanDussen KL, Carulli AJ, Keeley TM, Patel SR, Puthoff BJ, et al. (2012) Notch signaling modulates proliferation and differentiation of intestinal crypt base columnar stem cells. Development 139: 488–497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Hua G, Thin TH, Feldman R, Haimovitz-Friedman A, Clevers H, et al. (2012) Crypt base columnar stem cells in small intestines of mice are radioresistant. Gastroenterology 143: 1266–1276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Snippert HJ, van der Flier LG, Sato T, van Es JH, van den Born M, et al. (2010) Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell 143: 134–144. [DOI] [PubMed] [Google Scholar]
  • 41. Buczacki SJ, Zecchini HI, Nicholson AM, Russell R, Vermeulen L, et al. (2013) Intestinal label-retaining cells are secretory precursors expressing Lgr5. Nature 495: 65–69. [DOI] [PubMed] [Google Scholar]
  • 42. Ramalingam S, Daughtridge GW, Johnston MJ, Gracz AD, Magness ST (2012) Distinct levels of Sox9 expression mark colon epithelial stem cells that form colonoids in culture. Am J Physiol Gastrointest Liver Physiol 302: G10–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Gracz AD, Ramalingam S, Magness ST (2010) Sox9 expression marks a subset of CD24-expressing small intestine epithelial stem cells that form organoids in vitro. Am J Physiol Gastrointest Liver Physiol 298: G590–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Van Landeghem L, Santoro MA, Krebs AE, Mah AT, Dehmer JJ, et al. (2012) Activation of two distinct Sox9-EGFP-expressing intestinal stem cell populations during crypt regeneration after irradiation. Am J Physiol Gastrointest Liver Physiol 302: G1111–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Zweibaum A, Hauri HP, Sterchi E, Chantret I, Haffen K, et al. (1984) Immunohistological evidence, obtained with monoclonal antibodies, of small intestinal brush border hydrolases in human colon cancers and foetal colons. Int J Cancer 34: 591–598. [DOI] [PubMed] [Google Scholar]
  • 46. Ghaleb AM, McConnell BB, Kaestner KH, Yang VW (2011) Altered intestinal epithelial homeostasis in mice with intestine-specific deletion of the kruppel-like factor 4 gene. Dev Biol 349: 310–320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Rodriguez IR, Taravel FR, Whelan WJ (1984) Characterization and function of pig intestinal sucrase-isomaltase and its separate subunits. Eur J Biochem 143: 575–582. [DOI] [PubMed] [Google Scholar]
  • 48. Amasaki T, Amasaki H, Nagasao J, Ichihara N, Asari M, et al. (2001) Immunohistochemical localization of carbonic anhydrase isoenzymes in salivary gland and intestine in adult and suckling pigs. J Vet Med Sci 63: 967–970. [DOI] [PubMed] [Google Scholar]
  • 49. Ahlman H (2001) Nilsson (2001) The gut as the largest endocrine organ in the body. Ann Oncol 12 Suppl 2S63–68. [DOI] [PubMed] [Google Scholar]
  • 50. Portela-Gomes GM, Stridsberg M, Johansson H, Grimelius L (1997) Complex co-localization of chromogranins and neurohormones in the human gastrointestinal tract. J Histochem Cytochem 45: 815–822. [DOI] [PubMed] [Google Scholar]
  • 51. Bjerknes M, Cheng H (2006) Neurogenin 3 and the enteroendocrine cell lineage in the adult mouse small intestinal epithelium. Dev Biol 300: 722–735. [DOI] [PubMed] [Google Scholar]
  • 52. Gunawardene AR, Corfe BM, Staton CA (2011) Classification and functions of enteroendocrine cells of the lower gastrointestinal tract. Int J Exp Pathol 92: 219–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Kieffer TJ, Habener JF (1999) The glucagon-like peptides. Endocr Rev 20: 876–913. [DOI] [PubMed] [Google Scholar]
  • 54. Holst JJ (2007) The physiology of glucagon-like peptide 1. Physiol Rev 87: 1409–1439. [DOI] [PubMed] [Google Scholar]
  • 55.Johansson ME, Sjovall H, Hansson GC (2013) The gastrointestinal mucus system in health and disease. Nat Rev Gastroenterol Hepatol. Available: http://dx.doi.org/10.1038/nrgastro.2013.35. Accessed 16 May 2013. [DOI] [PMC free article] [PubMed]
  • 56. Debray H, Decout D, Strecker G, Spik G, Montreuil J (1981) Specificity of twelve lectins towards oligosaccharides and glycopeptides related to N-glycosylproteins. Eur J Biochem 117: 41–55. [DOI] [PubMed] [Google Scholar]
  • 57. Myer MS (1982) The presence of paneth cells confirmed in the pig. Onderstepoort J Vet Res 49: 131–132. [PubMed] [Google Scholar]
  • 58.Trautmann A (1952) Fundamentals of the histology of domestic animals. Ithaca, N.Y., Comstock Pub. Associates. 205 p.
  • 59. Farin HF, Van Es JH, Clevers H (2012) Redundant sources of wnt regulate intestinal stem cells and promote formation of paneth cells. Gastroenterology 143: 1518–1529. [DOI] [PubMed] [Google Scholar]
  • 60. Sato T, van Es JH, Snippert HJ, Stange DE, Vries RG, et al. (2011) Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469: 415–418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Cheng H (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. II. mucous cells. Am J Anat 141: 481–501. [DOI] [PubMed] [Google Scholar]
  • 62. Cheng H, Leblond CP (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. III. entero-endocrine cells. Am J Anat 141: 503–519. [DOI] [PubMed] [Google Scholar]
  • 63. Cheng H (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. IV. paneth cells. Am J Anat 141: 521–535. [DOI] [PubMed] [Google Scholar]
  • 64. Barker N, van Oudenaarden AF, Clevers H (2012) Identifying the stem cell of the intestinal crypt: Strategies and pitfalls. Cell stem cell 11: 452–460. [DOI] [PubMed] [Google Scholar]
  • 65. Satoh Y, Yamano M, Matsuda M, Ono K (1990) Ultrastructure of paneth cells in the intestine of various mammals. J Electron Microsc Tech 16: 69–80. [DOI] [PubMed] [Google Scholar]
  • 66.Dellmann H (1987) Textbook of veterinary histology. Philadelphia: Lea & Febiger. 187–192 p.
  • 67. Dobbins WO 3rd, Austin LL (1991) Electron microscopic definition of intestinal endocrine cells: Immunogold localization and review. Ultrastruct Pathol 15: 15–39. [DOI] [PubMed] [Google Scholar]
  • 68. Pellegrinet L, Rodilla V, Liu Z, Chen S, Koch U, et al. (2011) Dll1- and dll4-mediated notch signaling are required for homeostasis of intestinal stem cells. Gastroenterology 140: 1230–1240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Davidson LA, Goldsby JS, Callaway ES, Shah MS, Barker N, et al. (2012) Alteration of colonic stem cell gene signatures during the regenerative response to injury. Biochim Biophys Acta 1822: 1600–1607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Sang Y, Patil AA, Zhang G, Ross CR, Blecha F (2006) Bioinformatic and expression analysis of novel porcine beta-defensins. Mamm Genome 17: 332–339. [DOI] [PubMed] [Google Scholar]
  • 71. Li Q, Domig KJ, Ettle T, Windisch W, Mair C, et al. (2011) Evaluation of potential reference genes for relative quantification by RT-qPCR in different porcine tissues derived from feeding studies. Int J Mol Sci 12: 1727–1734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Pinto D, Gregorieff A, Begthel H, Clevers H (2003) Canonical wnt signals are essential for homeostasis of the intestinal epithelium. Genes Dev 17: 1709–1713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. van der Flier LG, Haegebarth A, Stange DE, van de Wetering M, Clevers H (2009) OLFM4 is a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells. Gastroenterology 137: 15–17. [DOI] [PubMed] [Google Scholar]
  • 74. van der Flier LG, van Gijn ME, Hatzis P, Kujala P, Haegebarth A, et al. (2009) Transcription factor achaete scute-like 2 controls intestinal stem cell fate. Cell 136: 903–912. [DOI] [PubMed] [Google Scholar]
  • 75. Blache P, van de Wetering M, Duluc I, Domon C, Berta P, et al. (2004) SOX9 is an intestine crypt transcription factor, is regulated by the wnt pathway, and represses the CDX2 and MUC2 genes. J Cell Biol 166: 37–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Jung P, Sato T, Merlos-Suarez A, Barriga FM, Iglesias M, et al. (2011) Isolation and in vitro expansion of human colonic stem cells. Nat Med 17: 1225–1227. [DOI] [PubMed] [Google Scholar]
  • 77. Sato T, Stange DE, Ferrante M, Vries RG, Van Es JH, et al. (2011) Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and barrett's epithelium. Gastroenterology 141: 1762–1772. [DOI] [PubMed] [Google Scholar]
  • 78. Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, et al. (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459: 262–265. [DOI] [PubMed] [Google Scholar]
  • 79. Gracz AD, Ramalingam S, Magness ST (2010) Sox9 expression marks a subset of CD24-expressing small intestine epithelial stem cells that form organoids in vitro. Am J Physiol Gastrointest Liver Physiol 298: G590–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Stelzner M, Helmrath M, Dunn JC, Henning SJ, Houchen CW, et al. (2012) A nomenclature for intestinal in vitro cultures. Am J Physiol Gastrointest Liver Physiol 302: G1359–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.National Institute of Health (2012) NIH symposium; Improving animal models for regenerative medicine. Bethesda, MD. May 23–24, 2012. Available: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&cad=rja&sqi=2&ved=0CDoQFjAB&url=http%3A%2F%2Fdpcpsi.nih.gov%2Forip%2Fdocuments%2Fsummary_of_the_improving_animal_models.pdf&ei=-AFnUaG8EoWk8QS-84DYDw&usg=AFQjCNHY2Xm_XImMA23QBozZU24wvE4Q6g. Accessed 2012 May 26.
  • 82. Blikslager AT, Roberts MC, Argenzio RA (1999) Prostaglandin-induced recovery of barrier function in porcine ileum is triggered by chloride secretion. Am J Physiol 276: G28–36. [DOI] [PubMed] [Google Scholar]
  • 83. Blikslager AT, Rhoads JM, Bristol DG, Roberts MC, Argenzio RA (1999) Glutamine and transforming growth factor-alpha stimulate extracellular regulated kinases and enhance recovery of villous surface area in porcine ischemic-injured intestine. Surgery 125: 186–194. [PubMed] [Google Scholar]
  • 84. Rhoads JM, MacLeod RJ, Hamilton JR (1989) Diminished brush border membrane na-dependent L-alanine transport in acute viral enteritis in piglets. J Pediatr Gastroenterol Nutr 9: 225–231. [DOI] [PubMed] [Google Scholar]
  • 85. Rhoads JM, Keku EO, Bennett LE, Quinn J, Lecce JG (1990) Development of L-glutamine-stimulated electroneutral sodium absorption in piglet jejunum. Am J Physiol 259: G99–107. [DOI] [PubMed] [Google Scholar]
  • 86. Rhoads JM, Keku EO, Quinn J, Woosely J, Lecce JG (1991) L-glutamine stimulates jejunal sodium and chloride absorption in pig rotavirus enteritis. Gastroenterology 100: 683–691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87. Tang ZH, Qiang JW, Feng XY, Li RK, Sun RX, et al. (2010) Acute mesenteric ischemia induced by ligation of porcine superior mesenteric vein: Multidetector CT evaluations. Acad Radiol 17: 1146–1152. [DOI] [PubMed] [Google Scholar]
  • 88. Smith F, Clark JE, Overman BL, Tozel CC, Huang JH, et al. (2010) Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastrointest Liver Physiol 298: G352–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89. Wrackmeyer U, Hansen GH, Seya T, Danielsen EM (2006) Intelectin: A novel lipid raft-associated protein in the enterocyte brush border. Biochemistry 45: 9188–9197. [DOI] [PubMed] [Google Scholar]
  • 90. Flisikowska T, Merkl C, Landmann M, Eser S, Rezaei N, et al. (2012) A porcine model of familial adenomatous polyposis. Gastroenterology 143: 1173–1175. [DOI] [PubMed] [Google Scholar]
  • 91. Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, et al. (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449: 1003–1007. [DOI] [PubMed] [Google Scholar]
  • 92. Furuyama K, Kawaguchi Y, Akiyama H, Horiguchi M, Kodama S, et al. (2011) Continuous cell supply from a Sox9-expressing progenitor zone in adult liver, exocrine pancreas and intestine. Nat Genet 43: 34–41. [DOI] [PubMed] [Google Scholar]
  • 93. Potten CS, Loeffler M (1990) Stem cells: Attributes, cycles, spirals, pitfalls and uncertainties. lessons for and from the crypt. Development 110: 1001–1020. [DOI] [PubMed] [Google Scholar]
  • 94. Dekaney CM, Gulati AS, Garrison AP, Helmrath MA, Henning SJ (2009) Regeneration of intestinal stem/progenitor cells following doxorubicin treatment of mice. Am J Physiol Gastrointest Liver Physiol 297: G461–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Yan KS, Chia LA, Li X, Ootani A, Su J, et al. (2012) The intestinal stem cell markers Bmi1 and Lgr5 identify two functionally distinct populations. Proc Natl Acad Sci U S A 109: 466–471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96. Munoz J, Stange DE, Schepers AG, van de Wetering M, Koo BK, et al. (2012) The Lgr5 intestinal stem cell signature: Robust expression of proposed quiescent ‘+4’ cell markers. EMBO J 31: 3079–3091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Breault DT, Min IM, Carlone DL, Farilla LG, Ambruzs DM, et al. (2008) Generation of mTert-GFP mice as a model to identify and study tissue progenitor cells. Proc Natl Acad Sci U S A 105: 10420–10425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Montgomery RK, Carlone DL, Richmond CA, Farilla L, Kranendonk ME, et al. (2011) Mouse telomerase reverse transcriptase (mTert) expression marks slowly cycling intestinal stem cells. Proc Natl Acad Sci U S A 108: 179–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99. Tian H, Biehs B, Warming S, Leong KG, Rangell L, et al. (2011) A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable. Nature 478: 255–259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100. Sangiorgi E, Capecchi MR (2008) Bmi1 is expressed in vivo in intestinal stem cells. Nat Genet 40: 915–920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101. Powell AE, Wang Y, Li Y, Poulin EJ, Means AL, et al. (2012) The pan-ErbB negative regulator Lrig1 is an intestinal stem cell marker that functions as a tumor suppressor. Cell 149: 146–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102. Marathe CS, Rayner CK, Jones KL, Horowitz M (2013) Glucagon-like peptides 1 and 2 in health and disease: A review. Peptides 44: 75–86. [DOI] [PubMed] [Google Scholar]
  • 103. Paris MC, Fuller PJ, Carstensen B, Nagy E, Taylor RG, et al. (2004) Plasma GLP-2 levels and intestinal markers in the juvenile pig during intestinal adaptation: Effects of different diet regimens. Dig Dis Sci 49: 1688–1695. [DOI] [PubMed] [Google Scholar]
  • 104. Garrison AP, Dekaney CM, von Allmen DC, Lund PK, Henning SJ, et al. (2009) Early but not late administration of glucagon-like peptide-2 following ileo-cecal resection augments putative intestinal stem cell expansion. Am J Physiol Gastrointest Liver Physiol 296: G643–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105. Rowland KJ, Brubaker PL (2011) The “cryptic” mechanism of action of glucagon-like peptide-2. Am J Physiol Gastrointest Liver Physiol 301: G1–8. [DOI] [PubMed] [Google Scholar]
  • 106. Voortman T, Hendriks HF, Witkamp RF, Wortelboer HM (2012) Effects of long- and short-chain fatty acids on the release of gastrointestinal hormones using an ex vivo porcine intestinal tissue model. J Agric Food Chem 60: 9035–9042. [DOI] [PubMed] [Google Scholar]
  • 107. Zhou C, Zhao J, Li J, Wang H, Tang C (2013) Acute ethanol administration inhibits toll-like receptor 4 signaling pathway in rat intestinal epithelia. Alcohol 47: 231–239. [DOI] [PubMed] [Google Scholar]
  • 108. Du Plessis J, Vanheel H, Janssen CE, Roos L, Slavik T, et al. (2013) Activated intestinal macrophages in patients with cirrhosis release NO and IL-6 that may disrupt intestinal barrier function. J Hepatol 58: 1125–1132. [DOI] [PubMed] [Google Scholar]
  • 109. Wagner JE, Beamer PD, Ristic M (1973) Electron microscopy of intestinal epithelial cells of piglets infected with a transmissible gastroenteritis virus. Can J Comp Med 37: 177–188. [PMC free article] [PubMed] [Google Scholar]
  • 110. Gayle J, Jones SL, Argenzio RA, Blikslager AT (2002) Neutrophils increase paracellular permeability of restituted ischemic-injured porcine ileum. Surgery 132: 461–470. [DOI] [PubMed] [Google Scholar]
  • 111. O'Brien LE, Soliman SS, Li X, Bilder D (2011) Altered modes of stem cell division drive adaptive intestinal growth. Cell 147: 603–614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112. VanDussen KL, Samuelson LC (2010) Mouse atonal homolog 1 directs intestinal progenitors to secretory cell rather than absorptive cell fate. Dev Biol 346: 215–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113. Yang Q, Bermingham NA, Finegold MJ, Zoghbi HY (2001) Requirement of Math1 for secretory cell lineage commitment in the mouse intestine. Science 294: 2155–2158. [DOI] [PubMed] [Google Scholar]
  • 114. Rothenberg ME, Nusse Y, Kalisky T, Lee JJ, Dalerba P, et al. (2012) Identification of a ckit+ colonic crypt base secretory cell that supports Lgr5+ stem cells in mice. Gastroenterology 142: 1195–1205. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES