Table 2.
The most abundantly cloned tRF-5s.
| Sequence | Parental |
Relative cloning frequency (‰) |
|||
|---|---|---|---|---|---|
| Mock |
Ricketsia infection |
||||
| day 1 | day 3 | ||||
| tRF5-ValGTG |
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT* |
tRNA-Val GTG, tRNA Val GTY |
3.984 |
6.494 |
12.950 |
| tRF5-GlyGCC |
GCATTGGTGGTTCAGTGGTAGAATTCTCGC* |
tRNA-Gly-GYY, tRNA-Gly-GGG |
4.767 |
5.734 |
7.638 |
| tRF5-GlyGCC (A to C) |
GCCTTGGTGGTTCAGTGGTAGAATTCTCGC |
tRNA-Gly-GYY, tRNA-Gly-GGG |
2.977 |
3.954 |
4.791 |
| tRF5-GluCTC |
TCCCTGGTGGTCTAGTGGTTAGGATTCGGC |
tRNA-Glu-GAG |
0.700 |
0.501 |
1.108 |
| tRF5-LysCTT | TCCCTGGTGGTCTAGTGGTTAGGATTCGGC | tRNA-Lys-AAG | 0.429 | 0.577 | 1.144 |
For individual tRF-5 sequences, their relative cloning frequencies were calculated as described in the Figure 6 legend. Based on the value (expressed in ‰ [1 per 1,000]), the most abundantly cloned tRF-5s were selected and tabulated. Among the five tRF-5s, two (tRF5-ValGTG and tRF5-GlyGCC: highlighted by asterisks in their sequences) were chosen for further study. “tRF5-GlyGCC (A to C)” has been assigned as a tRF-5, because we failed to find its identical sequence in any database and it mapped to tRF5-GlyGCC perfectly, except that the third nucleotide was C while the correct one in the mouse genome database is A.