Table 1. Primers and plasmids used in this study.

Primers	Sequence 5′ → 3′	Aim
Cfp21-D54R-Fwd	cttctggtcttggccgcgtcggtgaggcgttc	A1 mutants
Cfp21-D54R-Rev	gaacgcctcaccgacgcggccaagaccagaag	A1 mutants
Cfp21-GDFL-Fwd	gaactacccagcaagcggcgacttcctcgcgagcg	A2 mutants
Cfp21-GDFL-Rev	cgctcgcgaggaagtcgccgcttgctgggtagttc	A2 mutants
Cfp21-RWR-Fwd	gcaccggaggcggccgttggagggcgcatgtttcgtatgttca	A3 mutants
Cfp21-RWR-Rev	tgaacatacgaaacatgcgccctccaacggccgcctccggtgc	A3 mutants
Plasmids	Description
pDest14-Cfp21-A1	pDest14-Cfp21 mutated to encode Arg instead of Asp in position 54 of Cfp21 (A1 mutant)
pDest14-Cfp21-A2	pDest14-Cfp21 mutated to encode Gly-Asp-Phe-Leu instead of Asp-Asp-Tyr-Arg in position 90 to 93 of Cfp21 (A2 mutant)
pDest14-Cfp21-A3	pDest14-Cfp21 mutated to encode Arg-Trp-Arg instead of Asn-Ile-Met in position 183 to 185 of Cfp21 (A3 mutant)
pDest14-Cfp21-A1A2	pDest14-Cfp21 with A1 and A2 mutations
pDest14-Cfp21-A1A3	pDest14-Cfp21 with A1 and A3 mutations
pDest14-Cfp21-A2A3	pDest14-Cfp21 with A2 and A3 mutations
pDest14-Cfp21-TM	pDest14-Cfp21 with the 3 mutations (A1, A2, and A3) named TM (triple mutant)

Nucleotides of the primers that differ from the wild type sequence are presented in bold.