Fig. 5.
Identification of a chromosomal break in MLLT4. PCR amplification of different DNAs with either primer from the 5′ end (5′ATGTCGGCGGGCGGCCGTG3′ and 5′CCAAATCCTCGGTCGGCTGG3′) or with primer from the 3′ end (5′TGCCGGTGATTTCGATGGAATG3′ and 5′CTATCCCCATGGGAAACACGC3′) which amplified 112- and 763-bp fragments, respectively. Italicized nucleotides in one of the first primer pairs do not match with the first exon and the underlined nucleotide is next to the end of the first exon with the result that this primer pair amplifies the entire first exon (105 bp) but the length of the amplified fragment is 112 bp. HSF43 and HS74 are 2 normal human diploid fibroblast cell lines. HALneo and AR5 are immortal cells lines. Type I and Type II mouse/HAL hybrids carry 6q* and 6qt chromosomes, respectively.