Table 1.

Expression analysis of different genes from the 6q27 region (between MLLT4 and TBP) in normal (HS74) and preimmortal (SV.RNS/HF) cell lines

Genes/ESTs	Fragment size	Starting nucleotide position of the forward primer	Forward primer sequence (5'→3')	Reverse primer sequence (5'→ 3')	HS74 RNA	Preimmortal (SV.RNS/HF) RNA
MLLT4	723	168,095,029	tgccggtgatttcgatggaatg	ctatccccatgggaaacacgc	+	+
C6orf54	171	168,137,343	cagagtgccgagaccctgctag	gagacgtgggtggaaggtggtt	–	–
KIF25	240	168,182,158	gaccttctggccaaagacag	gcaggaggctgtggttagag	+	+
FRMD1	286	168,207,245	gactacatcctccggcacat	tctccagcttctttcccaga	–	–
DACT2	109	168,451,285	ctcagagccctccaagcactcg	tcgctgctgctggactcacg	–	–
SMOC2	180	168,585,308	tgcagaccccggacaagtggga	ccaaagcggtcgggagaacacg	–	–
THBS2	252	169,367,375	cgtggacaatgaccttgttg	caaatatcaccccgtccatc	+	+
WDR27	279	169,804,358	ctgagacttgcaccctgtga	gatctccaacacggcaatct	+	+
PHF10	244	169,852,305	aagctgccactccaagaaaa	cactgccatgggtaggtctt	+	+
TCTE3	254	169,893,470	acagagcgagatggagaagc	ttaattttgccagggcactc	–	–
OLLI	232	170,436,652	tccgctatccaggctgtctc	Gcagctccctccgttcttac	+	+
FAM120B	199	170,474,109	cgtccaagcagaaagctacc	ccactccttgacagctaggc	+	+

Expression of the above genes/ESTs was detected by RT-PCR using total RNA. Each RT-PCR experiment was repeated at least twice. In some cases another set of primers were also used to confirm the absence of expression. One tenth of the RT-PCR products were electrophoresed in 4% agarose gels containing ethidium bromide to visualize amplified products.

− indicates no amplification of the expected DNA fragment, whereas + indicates amplification of the expected gene fragment.