Skip to main content
. Author manuscript; available in PMC: 2013 Jul 18.
Published in final edited form as: Int J Non Linear Mech. 2008 Dec;43(10):1082–1093. doi: 10.1016/j.ijnonlinmec.2008.07.003

Table 1.

Calculated energy (in kT) and configurational parameters for O3-O1 LacR-mediated DNA loops.†

Loop α β Lk Ψ Φ GLacR GDNA ΔGDNA
A1a 34 33 9 32.1 71.9 – 117.7 36.5
A1b 34 33 10 39.1 70.0 – 122.7 41.4
A2a 34 33 8 33.1 71.6 – 118.0 36.7
A2b 34 33 9 41.6 70.3 – 125.3 44.1
P1a 34 33 9 38.8 73.0 – 123.4 42.2
P1b 34 33 10 62.5 71.3 – 145.4 64.1
P2a 34 33 9 71.3 73.4 – 145.4 77.4
P2b 34 33 10 45.7 70.8 – 130.4 49.1
Ea 8 41.2 70.0 2.8±1 127.2±1 45.9±1
Eb 9 23.1 68.3 2.8±1 107.4±1 26.1±1
Free – – – 0 68.2 – 81.2
†

Loops denoted by labels in Figure 3; LacR deformation angles (α,β) and closed pathway used to calculate Lk defined in Figure 2; Ψ: elastic energy; Φ: electrostatic energy at 10 mM salt; GLacR: free energy of LacR opening; GDNA: free energy of LacR-mediated loop at room temperature under the given ionic conditions. ΔGDNA free energy difference between loop and “free” DNA with bound LacR dimers. “Free” refers to the unconstrained linear DNA chain of the same wild-type (O3-O1) sequence: GGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATT. Here the O3 and O1 sequences are shown in boldface.