Table 1.
Loop | α | β | Lk | Ψ | Φ | GLacR | GDNA | ΔGDNA |
---|---|---|---|---|---|---|---|---|
A1a | 34 | 33 | 9 | 32.1 | 71.9 | – | 117.7 | 36.5 |
A1b | 34 | 33 | 10 | 39.1 | 70.0 | – | 122.7 | 41.4 |
A2a | 34 | 33 | 8 | 33.1 | 71.6 | – | 118.0 | 36.7 |
A2b | 34 | 33 | 9 | 41.6 | 70.3 | – | 125.3 | 44.1 |
P1a | 34 | 33 | 9 | 38.8 | 73.0 | – | 123.4 | 42.2 |
P1b | 34 | 33 | 10 | 62.5 | 71.3 | – | 145.4 | 64.1 |
P2a | 34 | 33 | 9 | 71.3 | 73.4 | – | 145.4 | 77.4 |
P2b | 34 | 33 | 10 | 45.7 | 70.8 | – | 130.4 | 49.1 |
Ea | 8 | 41.2 | 70.0 | 2.8±1 | 127.2±1 | 45.9±1 | ||
Eb | 9 | 23.1 | 68.3 | 2.8±1 | 107.4±1 | 26.1±1 | ||
Free | – | – | – | 0 | 68.2 | – | 81.2 |
Loops denoted by labels in Figure 3; LacR deformation angles (α,β) and closed pathway used to calculate Lk defined in Figure 2; Ψ: elastic energy; Φ: electrostatic energy at 10 mM salt; GLacR: free energy of LacR opening; GDNA: free energy of LacR-mediated loop at room temperature under the given ionic conditions. ΔGDNA free energy difference between loop and “free” DNA with bound LacR dimers. “Free” refers to the unconstrained linear DNA chain of the same wild-type (O3-O1) sequence: GGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATT. Here the O3 and O1 sequences are shown in boldface.