Table 1.

Primer sequences, annealing temperatures, and PCR fragment lengths used for SSCP analysis.

Exon	Sense Primer	Antisense Primer	Anneal Temp. (°C)	Size of exon (bp)1	Size of PCR product (bp)
2	ggtcttcccctcatcttgc	cccggcccaaggtgcctt	54	182	229
3	ggtcctgaattttgctccag	ggctggcgttttgcaaacat	51	181	223
4	tgactgtgctctgtccccc	caccgggcccacccttgg	57	228	308
5	cctttccccatcactgcc	caccccaacagtgacctc	53	130	170
6	gcccctctctctgccttc	ggacccctgagcactctc	55	209	249
7	ttgctccccgctcccgcc	ggggcaaaccagggcctc	57	109	149
8	ctggctgccctttgtcacac	ttcgtggagcccttgtctg	54	126	268
9	gtcggctctttcacttcc	aagcctggagggcacttg	51	202	275

¹Sizes of exons 2 and 9 indicate coding region of EH gene.