Table 2.
Primers used in this study
| Primer | Sequence (5′ to 3′) | Region amplified and primer direction | Purpose | Reference |
|---|---|---|---|---|
| ModMgPa1 | TGAAACCTTAACCCCTTGG | Conserved region of mgpB; upstream primer | Quantification of M. genitalium genomes by qPCR | 49 |
| ModMgPa3 | AGGGGTTTTCCATTTTTGC | Conserved region of mgpB; downstream primer | Quantification of M. genitalium genomes by qPCR | 49 |
| 3F | CAAAAATGGAAAACCCCTCAA | Region B of mgpB; upstream primer | Amplification of mgpB region B for assessment of gene variation | 34 |
| 3R | ATCATAGAAACTACCACCGTCG | Region B of mgpB; downstream primer | Amplification of mgpB region B for assessment of gene variation | 34 |
| ModPetF | GTGATGTTGTTAGTGATTGTGTG | Region B of mgpB; upstream primer | Amplification of mgpB region B, second primer pair | This study |
| 1415R | TGGTGGTAAACATCTTAGTAGCAT | Region B of mgpB; downstream primer | Amplification of mgpB region B, second primer pair | This study |
| Par8-F | TCAAAATAGAGTGTTGTGGGTCG | Region B-homologous region of MgPar8; upstream primer | Amplification of MgPar8 of strain G37-C and wk 8 variant for assessment of gene variation | 35 |
| Par8B-R | CGATTCAGGGGAGAAAGTC | Region B-homologous region of MgPar8; downstream primer | Amplification of MgPar8 of strain G37-C and wk 8 variant for assessment of gene variation | This study |
| rMgpB:B-F | GACGACGACAAGATAGGTAAAGTTCCAGTAGAAGTAGTT | Region B of mycobacterial G37-C mgpB inoculum; upstream primer | Construction of plasmids for expression of His-tagged MgpB region B peptides | This study |
| rMgpB:BG37−C-R | GAGGAGAAGCCCGGTGTATGGTTTTCACTGTAGGG | Region B of mycobacterial G37-C mgpB inoculum; downstream primer | Construction of plasmids for expression of His-tagged MgpB region B peptides | This study |
| rMgpB:BWk8-R | GAGGAGAAGCCCGGATCATAGAAACTAACCACCGT | Region B of mgpB week 8 variant; downstream primer | Construction of plasmids for expression of His-tagged MgpB region B peptides | This study |