Table 4.
Primers used
| Genomic | |||||
| Name | Nucleotide sequence | region | Position* | Strandedness | specificity |
| ga31 | ttgtcggtgctgatctcagtgga | exon 3 | 362 to 383 | sense | RHD |
| ga41 | acatgatgcacatctacgtgttcgc | exon 4 | 503 to 527 | sense | RHD/RHCE |
| ga42 | cagacaaactgggtatcgttgctg | exon 4 | 625 to 602 | antisense | RHD/RHCE |
| ga51 | ctgctcaccttgctgatcttccc | intron 5/exon. | 5 8 to 787 | antisense | RHD |
| ga61 | caggtacttggctcccccgac | exon 6 | 936 to 916 | antisense | RHD |
| ga62 | ttatgtgcacagtgcggtgttgg | exon 6 | 804 to 826 | sense | RHD/RHCE |
| ga71 | gttgtaaccgagtgctggggattc | exon 7 | 944 to 967 | sense | RHD/RHCE |
| ga72 | tgccggctccgacggtatc | exon 7 | 1066 to 1048 | antisense | RHD |
| rb12 | tcctgaacctgctctgtgaagtgc | intron 4 | 198 to 175 | antisense | RHD |
| rb21 | aggtccctcctccagcac | intron 3 | 28 to 11 | antisense | RHD/RHCE |
| rb24 | agacctttggagcaggagtg | intron 4 | -53 to -34 | sense | RHD/RHCE |
| rb26 | aggggtgggtagggaatatg | intron 6 | -62 to -43 | sense | RHD/RHCE |
| rb45 | acactgttgrctgaatttcggtgc | intron 1 | 164 to 139 | antisense | RHD/RHCE |
| rb51 | gcatgacgtgttctgcctcttg | intron 7 | -3365 to - 3386 | antisense | RHD |
| rb52 | ccaggttgttaagcattgctgtacc | intron 7 | -3433 to -3409 | sense | RHD |
| re04 | aggtcacatccatttatcccactg | promoter | -2498 to -2474 | sense | RHD/RHCE |
| re08 | gggcttgggacttagttctaac | promoter | -858 to -879 | antisense | RHD/RHCE |
| re09 | cgactgggtgattaaaatctcc | promoter | -1280to-1259 | sense | RHD/RHCE |
| re011d | gcagccaacttcccctgtg | promoter | -883 to -905 | antisense | RHD |
| re012 | tccactttccacctccctgc | promoter | -1148to-1122 | sense | RHD |
| relld | agaagatgggggaatctttttcct | intron 1 | 129 to 106 | antisense | RHD/RHCE |
| re41 | cgatacccagtttgtctgccatgc | exon 4 | 608 to 631 | sense | RHD/RHCE |
| re71 | acccagcaagctgaagttgtagcc | exon 7 | 1,008 to 985 | antisense | RHD |
| re74 | tatccatgaggtgctgggaac | intron 7 | -244 to -224 | sense | RHD/RHCE |
| re721 | ctggaggctctgagaggttgag | intron 7 | -348 to -326 | sense | RHD |
| re83 | gagattaaaaatcctgtgctcca | intron 8 | -54 to - 34 | sense | RHD/RHCE |
| re93 | cacccgcatgtcagactatttggc | intron 9 | 320 to 297 | antisense | RHD/RHCE |
| re93k | gccaaatagtttgacatgcgggtg | intron 9 | 297 to 320 | sense | RHD/RHCE |
| re94 | cttggtcatcaaaatatttagcct | exon 9 | 1216 to 1193 | antisense | RHD |
| re916 | gtttttgaggcaaagtctcgctc | intron 9 | 1689 to 1666 | antisense | RHD/RHCE |
| rea7 | tgttgcctgcatttgtacgtgag | 3' UTR† | 1311 to 1333 | sense | RHD/RHCE |
| rend31k | cctccccaacccagacagaattag | AJ252311‡ | 8506 to 8529 | sense | not applicable |
| rend9b1 | cactgcacttggcaccattgag | AL031432 | 29489 to 29468 | antisense | not applicable |
| rend9b2 | ttccgaaggctgcttttccc | AL031432 | 28840 to 28859 | sense | not applicable |
| Rh152Tb | gatattactgatgaccatcctcatgg | exon3 | 480 to 455 | antisense | RHCE |
| Rh223Vf | ttgtggatgttctggccaagtg | exon 5 | 646 to 667 | sense | RHCE |
| Rh245Vb | gctgtcaccactctgactgctac | exon5 | 755 to 733 | antisense | RHD |
| RhPsiB | tctgatctttatcctccgttccctc | exon 4 | 601 to 577 | antisense | RHD |
| RhPsiF | agacagactaccacatgaacttac | intron 3 | -38 to-15 | sense | RHDψ |
| RhX1f1 | cgctgcctgcccctctga | exon 1 | 31 to 48 | sense | RHD(W16X) |
| rr4 | agcttactggatgaccacca | 3'UTR | 1,541 to 1,522 | antisense | RHD |
*The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons including the 3' untranslated part of exon 10, relative to their adjacent exon/intron boundaries of RHCE for primers in introns; and according to the numbering in the genomic sequences indicated. Primers rh1 [44], ga31 (previously dubbed D-3-383), ga41 (D-4-527), ga42 (D-4-602), ga51 (D-5-787), ga61 (D-6-916), ga62 (D-6-826), ga71 (D-7-967), ga72 (D-7-1048) [27], rb5, rb12, rb24, rh5, rh7 [31], rb21, rb26, re11d, re71, re74, re83, re93, rr4 [32], re012 [29], re011d and rea7 [7] have been published previously. † 5' UTR: 5' untranslated region of exon 1; 3' UTR: 3' untranslated region of exon 10. ‡ Accession number of nucleic acid sequence in EMBL/GenBank/DDBJ; AJ252311 represents upstream Rhesus box; AL031431 Chromosome 1 genomic clone dJ465N24.