Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotides.
| Name/region | Sequence (5′-3′) | Reference |
|---|---|---|
| lvh1/lvhB3 | attgggagcttctggcaata | This study |
| lvh2/lvhB3 | gctggggtgacctttgaata | This study |
| rtx1/rtxA | gctgcaaccacctctttgat | This study |
| rtx2/rtxA | caggggctggttatgttgat | This study |
| dot1/dotA | caaatccggcattcaaaatc | This study |
| dot2/dotA | ctattgtcgccttgggtgtt | This study |
| hsp1/hsp60 | gcgaatcgttgttaccaaagaaaac | [15] |
| hsp2/hsp60 | caatttgacgcattggagattcaatag | [15] |
| mip1/mip | ggtgactgcggctgttatgg | [16] |
| mip2/mip | ggccaataggtccgccaacg | [16] |
