. 2013 Jul 24;6:215. doi: 10.1186/1756-3305-6-215

Table 1.

PCR primer sets for amplification of SSU rRNA region of Blastocystis from dog faeces

Primer	Primer name and sequence (5′ to 3′)	Product size
Single step PCR conditions as per Scicluna et al. [14]	BhRDr -GAGCTTTTTAACTGCAACAACG	600 bp
Single step PCR conditions as per Scicluna et al. [14]	RD5 –ATCTGGTTGATCCTGCCAGT	600 bp
Nested PCR–primary set, conditions as per Clark [13]	RD3-GGGATCCTGATCCTTCCGCAGGTTCACCTAC	1800 bp
Nested PCR–primary set, conditions as per Clark [13]	RD5 -GGAAGCTTATCTGGTTGATCCTGCCAGTA	1800 bp
Nested PCR – secondary set, conditions as per Bohm-Gloning [15], using 1 ul of PCR product from primary step.	Forward -GGAGGTAGTGACAATAAATC	1100 bp
	Reverse - CGTTCATGATGAACAATTAC	1100 bp