Table 1. Details of real-time RT-PCR primers and results of confirmation.

ProbeName	Primer(5′-3′)	Size (bp)	Real-time FCa	Microarry FCb	Description
CUST_551	FP:agatcgcgttcaaacaacaaRP:atctgccggatatgaaccaa	196	−2.63	−6.84	Expressed protein
CUST_12936	FP:gaacgtgatgctgttgttgcRP:atcctcgacatcccaatcag	192	−2.64	−7.27	Prostatic spermine-binding protein precursor (SBP)
CUST_4819	FP:ttaagcgggatcaatggaagRP:caccacgacgtgttaattgc	210	−2.05	−2.14	Solute carrier family 6 (ko:K05045)
CUST_12988	FP:ctgctgtggagggaatgtttRP:tggaggattccaggtttcag	219	50	12.56	Putative uncharacterized protein C14orf165
CUST_4112	FR:gttattggatttcccgctcaPR:atggcaatgaaagtgcatca	199	3.34	6.34	Cyclin-dependent kinase 6, CDK6
CUST_10350	FR:ggattgattccgccattacPR:gaatggcagtattggttgacg	198	4.75	6.88	Asparagine-rich protein (Ag319) (ARP)
CUST_10723	FR:tgtgccgttattgcgtttagPR:attatcgcttttgccgtcag	178	2.11	4.73	Expressed protein
CUST_4101	FR:atactggtgagcggcctatgPR:gcattcgcaaaccatgtaga	230	3.52	4.88	Iroquois homeobox protein 3, IRX-3
CUST_5523	FR:gcgttcgccaattgaattatPR:tgttgtattgggtggggatt	184	5.2	2.56	Putative eukaryotic translation initiation factor 3 subunit (eIF-3)

^aFold change (FC) is the ratio of gene expression in schistosomes from water buffalo compared to those from goats; p<0.05, FDR<0.1;

^bMean FC in real-time PCR results for validation.