Table 2.
ITC analysis of RRM123 affinities and binding stoichiometriesfor various RNA substrates
| RNA | Kd (µM) | N (sites) | ΔH (kcal/mol) |
|---|---|---|---|
| UGUUUGUUUGU (EDEN11-GRE) | 2.20 ± 0.3 | 1.45 | −53.7 ± 1.4 |
| UGUUUUUUGU (EDEN-4U) | 2.08 ± 0.4 | 1.64 | −54.4 ± 1.7 |
| UGUAUGUGUUGUUUUAUGU (EDEN19) | 0.33 ± 0.07 | 0.79 | −111.4 ± 3.1 |
| UGUUUUGUUUUUUGU (EDEN-2U/4U) | 0.11 ± 0.02 | 0.85 | −51.8 ± 1.0 |
| UGUUUUGUUUGU (EDEN-2U/1U) | 1.49 ± 0.23 | 1.19 | −64.7 ± 2.9 |
| UGUUUUUUGUUUUGU (EDEN-4U/2U) | 0.98 ± 0.12 | 0.67 | −35.7 ± 1.0 |
| UGUUUUGUUCCCGAGGACGGGUUGU (EDEN-2U/HL) | 0.55 ± 0.08 | 0.83 | −69.0 ± 1.6 |
All data were collected at 25°C on 12.5 µM solutions of RRM123 dissolved in RNase free water buffered with 25 mM potassium phosphate and 100 mM NaCl at pH 7.0 and titrated with 300 µl of 125 µM RNA in the same buffer. Binding isotherms were fitted with MicroCal Origin software.