Table 2. Prediction of AphA/OpaR box-like sequences within upstream DNA regions.
| First gene |
AphA box-like sequence |
OpaR box-like sequence |
|||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Operon |
ID |
Name |
Position&
|
Sequence |
Score | Position&
|
Sequence |
Score | |||||||||||||||
| VPA1027-1024 | VPA1027 | hcp2 | R-119. . -100 | ATACGCTCCTTTATATCTTT | 3.98 | D-389…- 370 | TAATGACATTGTAGACAATA | 9.01 | |||||||||||||||
| D-87… 68 | TTTTGATACATCAATCATTA | 8.29 | |||||||||||||||||||||
| D-57. . -38 | TTCAGATAATTTAATTAATA | 9.45 | |||||||||||||||||||||
| VPA1043-1028 | VPA1043 | NA | R-196. . -177 | ATATCCAACCAGGTTCAAAT | 2.51 | D-356…- 337 | TATTTATAGATTTGTCTTTA | 9.33 | |||||||||||||||
| VPA1044-1046 | VPA1044 | NA | D-143. . -124 | ATATCCAACCAGGTTCAAAT | 2.51 | D-250. . -231 | TATTAACATTAAGATTAATA | 9.9 | |||||||||||||||
&, ‘D’ indicates the direct sequence while ‘R’ the reverse one; minus numbers denote the nucleotide positions upstream of indicated genes. NA, Not Applicable