Table 3.
Sequences of primers used for PCR and sequencing
| Primer | Sequence |
|---|---|
| rs3840870 forward | 5´GGTTCTCAGACTGCCAAAGAAG |
| rs3840870 reverse | 5´GCAACACAGTTACACAAGGAACA |
| rs3917 forward | 5´TTTCTGCTTGCCCAAGAAAC |
| rs3917 reverse | 5´CTTGAAGAATGTTGATGGTGCT |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.