Skip to main content
. 2013 Aug 29;8(8):e72959. doi: 10.1371/journal.pone.0072959

Table 1. Details of specific primers used in Real-Time PCR experiments.

GENE PRIMER SEQUENCE GenBank, accession # AMPLICON bp Ta, °C EFFICIENCY, % R2
Sdha F: CTCTTTTGGACCTTGTCGTCTTT NM_130428 102 60 104.7 0.999
Inline graphic R: TCTCCAGCATTTGCCTTAATCGG Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
Hprt1 F: CCCAGCGTCGTGATTAGTGATG NM_012583 125 60 103 0.998
Inline graphic R: TTCAGTCCTGTCCATAATCAGTC
Tbp F: CACCGTGAATCTTGGCTGTAAAC NM_001004198 123 60 105 0.998
Inline graphic R: CGCAGTTGTTCGTGGCTCTC Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
ANP F: AAGTGTAGATGAGTGGTT NM_012612 118 58 95.3 0.999
Inline graphic R: TGGTGCTGAAGTTTATTC Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
BNP F: ATCTGTCGCCGCTGGGAGGT NM_031545 187 60 101.1 0.999
Inline graphic R: TGGATCCGGAAGGCGCTGTCT Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
CNP F: GGAGCCAATCTCAAGGGA NM_053750 201 60 103.9 0.997
Inline graphic R: TGCCGCCTTTGTATTTGC Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
NPR-A F: AGAGCCTGATAATCCTGAGTA NM_012613 81 58 95.4 0.998
Inline graphic R: A TCCACGGTGAAGTTGAAC Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
NPR-B F: CCCATCCTGTGATAAAACTCC NM_053838 89 60 104 0.999
Inline graphic R: AAGCTGGAAACACCAAACA Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
NPR-C F: GGACCGCGAAGCCTGAGTTTGAGA NM_012868 240 64 100.3 0.998
Inline graphic R: ATGGACACCTGCCCGGCGATACCT Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
IL-6 F: ACCACCCACAACAGACCAGT NM_012589 141 60 96 0.997
Inline graphic R: ACAGTGCATCATTCGCTGTTC Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic
TNF-α F: GCCCAGACCCTCACACTC NM_012675 98 60 105 0.997
Inline graphic R: CCACTCCAGCTGCTCCTCT Inline graphic Inline graphic Inline graphic Inline graphic Inline graphic

Legend: Sdha: Succinate dehydrogenase complex, subunit A, flavoprotein; Hprt1: Hypoxanthine phosphoribosyltransferase 1; Tbp: TATA binding protein; ANP: atrial natriuretic peptide; BNP: B-type (or brain) natriuretic peptide; CNP: C-type natriuretic peptide; NPR-A: Natriuretic peptide receptor A; NPR-B: Natriuretic peptide receptor B; NPR-C: Natriuretic peptide receptor C or clearance receptor; IL-6: Interleukin-6; TNF-α: Tumor necrosis factor-alpha.