Table 1.
Primer Sequences for Real-Time PCR
| Primer | Primer sequence |
|---|---|
| GAPDH | Hs99999905 (Applied Biosystems) |
| Serotonin transporter | Forward—51 CACAACCTCCTCCTCCAGTTC Reverse—51 CCCTTCCATCATCAGGCTTAGC |
| Monoamine oxidase A | Hs00165140 (Applied Biosystems) |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.