Table 1. Hras oligo probes sequences and modifications.
Oligonucleotide | Sequence (5′ –3′) |
1. HRAS-anchor-AF488 PS | C*C*C*G*C*A*U*G*G*C*A*C*U*A*U*A-AF488 |
2. HRAS-T-TR-8mer -PS | TR-U*C*T*A*G*A*C*C |
3. HRAS-A-TR-8mer -PS | TR -U*C*T*T*G*A*C*C |
4. HRAS-T-AF594 -8mer-PS | AF594-U*C*T*A*G*A*C*C |
5. HRAS-A-AF594 -8mer-PS | AF594-U*C*T*T*G*A*C*C |
6. HRAS-anchor-AF488 PSEnd | SpC3-C*CCGCAUGGCACUAU*A-AF488 |
7. HRAS-T-TR -8mer-PSEnd | TR-U*CTAGAC*C |
8. HRAS-A-TR -8mer-PSEnd | TR-UCTTGAC*C |
9. HRAS-U-targ RNA | acagcaggucuagaagaguauagugccaugcgggaccagu |
10. HRAS-A-targ RNA | acagcaggucaagaagaguauagugccaugcgggaccagu |
Key: A,C,U/T,G –2′OMe RNA, a,c,u,g – RNA, A,C,T,G - LNA residues, Bold font - SNP site, TR – Texas Red, AF – Alexa Fluor, “*” - phosphorothioate (PS) internucleotide linkage, PSEnd- incidates phosphorothioate bonds only on terminal linakges of the molecule, targ- target sequence.