Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
gB Primers sequences and PCR product sizes
| Round | Primer sequences | PCR product | |
|---|---|---|---|
| Forward | Reverse | ||
| 1st | gB 1319 TGGAACTGGAACGTTTGGC (22) | gB 1659 GCACCTTGACGCTGGTTTGG (9) | ~ 355 bp |
| 2st | gB 1319 TGGAACTGGAACGTTTGGC (22) | gB 1604 GAAACGCGCGGCAATCGG (22) | ~ 299–305 bp |
Note: All sequences are based on the AD 169 sequence (GenBank Accession No. X04606).
