Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in the 16S rDNA sequencing reactions.
| Primers | Sequence 5´→3´ | Reference |
|---|---|---|
| Y1 | tggctcagaacgaacgctggcggc | 26 |
| Y2 | cccactgctgcctcccgtaggagt | 26 |
| Y3 | ctgaccccacttcagcattgttccat | 12 |
| 16S362f | ctcctacgggaggcagtgggg | 21 |
| 16S786f | cgaaagcgtggggagcaaacagg | 21 |
| 16S1203r | gaggtgggatgacgtcaagtcctc | 21 |
| 16S1110r | tgcgctcgttgcgggacttaacc | 21 |
| 16S805r | gactaccagggtatctaatcctg | 21 |
