Table 2. Indel mutation frequencies at on- and off-target genomic sites induced by different amounts of Cas9- and sgRNA-expressing plasmids for the RGEN targeted to VEGFA Target Site 2.
Amounts of sgRNA- and Cas9-expressing plasmids transfected into U2OS.EGFP cells for these assays are shown at the top of each column. (Note that data for 250 ng sgRNA/750 ng Cas9 are the same as those presented in Table 1.) Mean indel frequencies were determined using the T7EI assay from replicate samples as described in Online Methods.
Site | Sequence | 250ng sgRNA/750 ng Cas9 Mean indel frequency (%) ± SEM |
12.5ng sgRNA/50 ng Cas9 Mean indel frequency (%) ± SEM |
---|---|---|---|
T2 (On-target) | GACCCCCTCCACCCCGCCTCCGG | 50.2 ± 4.9 | 25.4 ± 4.8 |
OT2-1 | GACCCCCCCCACCCCGCCCCCGG | 14.4 ±3.4 | 4.2 ± 0.2 |
OT2-2 | GGGCCCCTCCACCCCGCCTCTGG | 20.0 ± 6.2 | 9.8 ± 1.1 |
OT2-6 | CTACCCCTCCACCCCGCCTCCGG | 8.2 ± 1.4 | 6.0 ± 0.5 |
OT2-9 | GCCCCCACCCACCCCGCCTCTGG | 50.7 ± 5.6 | 16.4 ± 2.1 |
OT2-15 | TACCCCCCACACCCCGCCTCTGG | 9.7 ± 4.5 | 2.1 ± 0.0 |
OT2-17 | ACACCCCCCCACCCCGCCTCAGG | 14.0 ± 2.8 | 7.1 ± 0.0 |
OT2-19 | ATTCCCCCCCACCCCGCCTCAGG | 17.0 ± 3.3 | 9.2 ± 0.4 |
OT2-20 | CCCCACCCCCACCCCGCCTCAGG | 6.1 ± 1.3 | N.D. |
OT2-23 | CGCCCTCCCCACCCCGCCTCCGG | 44.4 ± 6.7 | 35.1 ± 1.8 |
OT2-24 | CTCCCCACCCACCCCGCCTCAGG | 62.8 ± 5.0 | 44.1 ± 4.5 |
OT2-29 | TGCCCCTCCCACCCCGCCTCTGG | 13.8 ± 5.2 | 5.0 ± 0.2 |
OT2-34 | AGGCCCCCACACCCCGCCTCAGG | 2.8 ± 1.5 | N.D. |
OT = Off-target sites, numbered as in Table 1 and Supplementary Table 2. Mismatches from the on-target site (within the 20 bp region to which the gRNA hybridizes) are highlighted as bold, underlined text. N.D. = none detected