Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Gene (human) | Primers (5'–3') | Probe |
|---|---|---|
| UBQLN2 | FW: gcagcctgaaggatcagtgta | 72 |
| RV: tgggagaagctgagaaggaa | ||
| GAPDH | FW: gctgagtccgcagcagg | 45 |
| RV: tgccaacagggagagcaga | ||
| BiP | FW: catcaagttcttgccgttca | 10 |
| RV: tcttcaggagcaaatgtctttgt |
Probe numbers refer to numbers in the Roche universal probe library.
