TABLE 1.
Strains, plasmids, phages, and oligos
| Description | Reference | |
|---|---|---|
| Strains | ||
| RS734 | MC4100 galEp3, Plac–H-19B nutR/tR1-lacZYA | J. Gowrishankar |
| RS445 | GJ3161, λRS88 lysogen carrying Plac–lacZYA | 22 |
| RS862 | MG1655 Δrac::tetR | J.Gowrishankar |
| RS1017 | MC4100 galEp3, λRS45 lysogen carrying Plac–H-19B nutR/tR1- trpt′-lacZYA | This study |
| RS1019 | MC4100 galEp3, Plac–λ nutR-tR1-lacZYA | This study |
| RS1148 | MC4100 galEp3, λRS45 lysogen carrying Plac–H-19B nutR/tR1- TR′-T1-T2–lacZYA | This study |
| RS1237 | MC4100 galEp3, Plac–λ nutR/tR1-TR′-T1-T2- lacZYA | This study |
| RS1245 | MC4100 galEp3, λRS45 lysogen carrying Plac–λ nutR/tR1-trpt′-lacZYA | This study |
| XL1-Red | endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac mutD5 mutS mutT Tn10 (tetR) | Stratagene |
| Phages | ||
| λRS45, λcI857 | J. Gowrishankar | |
| H-19B | David Friedman | |
| Plasmids | ||
| pK8601 | pGB2 with Plac-H-19B N, specR | 38 |
| pK8641 | pTL61T with Plac–H-19B-nutR-TR′-T1-T2-lacZYA fusion. TR′-T1-T2 is a triple terminator cassette, ampR | 38 |
| pHYD3011 | nusA and mutants of nusA were cloned into NdeI-SalI sites under pBAD promoter, ampR | 22 |
| pRS12 | H-19B N cloned at NdeI/XhoI site of pET21b, ampR | 23 |
| pRS22 | pTL61T with pT7A1–H-19B nutR-TR′-T1-T2-lacZYA, ampR | 23 |
| pRS24 | WT nusA cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | 23 |
| pRS25 | pTL61T with pT7A1–H-19B nutR (ΔcII) TR′-T1-T2-lacZYA,ampR | 23 |
| pRS256 | pGB2 with Plac-λN, specR | 19 |
| pRS385 | pRS25 with T7A1-nutR-lacO-TR′ fusion, ampR | 33 |
| pRS523 | WT nusA cloned at NdeI/XhoI site of pET33b, HMK, His tag at N terminus, kanR | 33 |
| pRS604 | pTL61T with pT7A1–λ nutR-T1T2-lacZYA, ampR | |
| pRS615 | λN cloned at NdeI/XhoI site of pET21b, ampR | |
| pRS703 | pHyd3011 having WT nusA | This study |
| pRS1005 | ΔAR1–2 NusA fragment cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | This study |
| pRS1011 | ΔAR2 NusA fragment cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | This study |
| pRS1100 | Zero-Cys nusA made by SDM on pET33b, HMK, his tag at N terminus, kanR | This study |
| pRS1101 | pHyd3011 having nusA V8A mutation | This study |
| pRS1102 | C454S(C251, C489) nusA made by SDM on pET33b, HMK, his tag at N terminus, kanR | This study |
| pRS1124 | nusA S29C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR | This study |
| pRS1127 | nusA V8A mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | This study |
| pRS1139 | Phyd3011 having nusA V12D | This study |
| pRS1140 | Phyd3011 having nusA V8E | This study |
| pRS1141 | Phyd3011 having nusA L31E | This study |
| pRS1149 | nusA V8E mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | This study |
| pRS1154 | Phyd3011 having nusA A11D | This study |
| pRS1163 | Phyd3011 having nusA A7D | This study |
| pRS1182 | nusA V12D mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR | This study |
| pRS1193 | nusA S53C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR | This study |
| pRS1205 | ΔAR1–2 NusA S53C cloned at NdeI/XhoI site of pET33b, HMK, his tag at N-terminus, kanR | This study |
| pRS1313 | nusA V8E S53C made by SDM on pRS1193, HMK, his tag at N-terminus, kanR | This study |
| pRS1407 | nusA T371C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR | This study |
| pRS1421 | λN C93S made by SDM on pRS615 | This study |
| pRS1422 | λN S39C made by SDM on pRS1421 | This study |
| pRS1425 | 39-Cys λN sub-cloned in pET33b, HMK, his tag at N terminus, kanR | This study |
| Oligos | ||
| RK1 | RS58 CGCCAGGGTTTTCCCAGTCACGAC; Reverse primer in the lacZ gene of pTL61T | |
| RS2 | CTTGCATGCCTGCAGGTCGACTC; Reverse primer after TR′ of pTL61T | |
| RK23b | TGGAGTTCCAGACGATACGTCG; reverse primer to generate T7A1- H-19B-nutR/tR1 terminator template | |
| RS58 | ATAAACTGCCAGGAATTGGGGATCG; forward primer of pTL61T (and all its derivatives like pRS106, pRS25) vector sequence | |
| RS83 | Biotinylated RS58 | |
| RS147 | GCGCGCGGATCCCCCCATTCAAGAACAGCAAGCAGC; reverse oligo to generate T7A1-λtR1 terminator template | |
| RS177 | GAATTGTGAGCGCTCACAATTCggatATATATTAACAATTACCTG; lacO fusion at 161U of trpt′ terminator | |
| RS367 | 5′ GGA ATG TGT AAG AGC GGG GTT ATT TAT GC 3′ 29-mer, antisense oligo to λ rutA, boxA, and spacer RNA | |
| RS663 | CGTAGGACGAATGTCCATTGTG; antisense to nutR spacer of H-19B | |