Skip to main content
. 2013 Aug 2;288(39):28089–28103. doi: 10.1074/jbc.M113.472209

TABLE 1.

Strains, plasmids, phages, and oligos

Description Reference
Strains
    RS734 MC4100 galEp3, PlacH-19B nutR/tR1-lacZYA J. Gowrishankar
    RS445 GJ3161, λRS88 lysogen carrying Plac–lacZYA 22
    RS862 MG1655 Δrac::tetR J.Gowrishankar
    RS1017 MC4100 galEp3, λRS45 lysogen carrying PlacH-19B nutR/tR1- trpt-lacZYA This study
    RS1019 MC4100 galEp3, Placλ nutR-tR1-lacZYA This study
    RS1148 MC4100 galEp3, λRS45 lysogen carrying PlacH-19B nutR/tR1- TR′-T1-T2–lacZYA This study
    RS1237 MC4100 galEp3, Placλ nutR/tR1-TR′-T1-T2- lacZYA This study
    RS1245 MC4100 galEp3, λRS45 lysogen carrying Placλ nutR/tR1-trpt-lacZYA This study
    XL1-Red endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac mutD5 mutS mutT Tn10 (tetR) Stratagene

Phages
    λRS45, λcI857 J. Gowrishankar
    H-19B David Friedman

Plasmids
    pK8601 pGB2 with Plac-H-19B N, specR 38
    pK8641 pTL61T with Plac–H-19B-nutR-TR′-T1-T2-lacZYA fusion. TR′-T1-T2 is a triple terminator cassette, ampR 38
    pHYD3011 nusA and mutants of nusA were cloned into NdeI-SalI sites under pBAD promoter, ampR 22
    pRS12 H-19B N cloned at NdeI/XhoI site of pET21b, ampR 23
    pRS22 pTL61T with pT7A1–H-19B nutR-TR′-T1-T2-lacZYA, ampR 23
    pRS24 WT nusA cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR 23
    pRS25 pTL61T with pT7A1–H-19B nutRcII) TR′-T1-T2-lacZYA,ampR 23
    pRS256 pGB2 with PlacN, specR 19
    pRS385 pRS25 with T7A1-nutR-lacO-TR′ fusion, ampR 33
    pRS523 WT nusA cloned at NdeI/XhoI site of pET33b, HMK, His tag at N terminus, kanR 33
    pRS604 pTL61T with pT7A1–λ nutR-T1T2-lacZYA, ampR
    pRS615 λN cloned at NdeI/XhoI site of pET21b, ampR
    pRS703 pHyd3011 having WT nusA This study
    pRS1005 ΔAR1–2 NusA fragment cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR This study
    pRS1011 ΔAR2 NusA fragment cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR This study
    pRS1100 Zero-Cys nusA made by SDM on pET33b, HMK, his tag at N terminus, kanR This study
    pRS1101 pHyd3011 having nusA V8A mutation This study
    pRS1102 C454S(C251, C489) nusA made by SDM on pET33b, HMK, his tag at N terminus, kanR This study
    pRS1124 nusA S29C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR This study
    pRS1127 nusA V8A mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR This study
    pRS1139 Phyd3011 having nusA V12D This study
    pRS1140 Phyd3011 having nusA V8E This study
    pRS1141 Phyd3011 having nusA L31E This study
    pRS1149 nusA V8E mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR This study
    pRS1154 Phyd3011 having nusA A11D This study
    pRS1163 Phyd3011 having nusA A7D This study
    pRS1182 nusA V12D mutant cloned at NdeI/XhoI site of pET28b, His tag at N terminus, kanR This study
    pRS1193 nusA S53C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR This study
    pRS1205 ΔAR1–2 NusA S53C cloned at NdeI/XhoI site of pET33b, HMK, his tag at N-terminus, kanR This study
    pRS1313 nusA V8E S53C made by SDM on pRS1193, HMK, his tag at N-terminus, kanR This study
    pRS1407 nusA T371C made by SDM on pRS1100, HMK, his tag at N-terminus, kanR This study
    pRS1421 λN C93S made by SDM on pRS615 This study
    pRS1422 λN S39C made by SDM on pRS1421 This study
    pRS1425 39-Cys λN sub-cloned in pET33b, HMK, his tag at N terminus, kanR This study

Oligos
    RK1 RS58 CGCCAGGGTTTTCCCAGTCACGAC; Reverse primer in the lacZ gene of pTL61T
    RS2 CTTGCATGCCTGCAGGTCGACTC; Reverse primer after TR′ of pTL61T
    RK23b TGGAGTTCCAGACGATACGTCG; reverse primer to generate T7A1- H-19B-nutR/tR1 terminator template
    RS58 ATAAACTGCCAGGAATTGGGGATCG; forward primer of pTL61T (and all its derivatives like pRS106, pRS25) vector sequence
    RS83 Biotinylated RS58
    RS147 GCGCGCGGATCCCCCCATTCAAGAACAGCAAGCAGC; reverse oligo to generate T7A1-λtR1 terminator template
    RS177 GAATTGTGAGCGCTCACAATTCggatATATATTAACAATTACCTG; lacO fusion at 161U of trpt′ terminator
    RS367 5′ GGA ATG TGT AAG AGC GGG GTT ATT TAT GC 3′ 29-mer, antisense oligo to λ rutA, boxA, and spacer RNA
    RS663 CGTAGGACGAATGTCCATTGTG; antisense to nutR spacer of H-19B