Table 1.
Primers and probes
Gene | Forward primer (5’-3’)* | Reverse primer (5’-3’)* | 5’ fluorophore† | Probe (5’-3’)* | 3’ quencher‡ | Amplicon length (bp) |
---|---|---|---|---|---|---|
HIF1α | agcagtctatttatattttctaca | agagcattaatgtaaattaagtag | FAM | tagaagcctggctacaatactgca | BHQ1 | 125 |
CD68 | caatggttcccagccctgtg | tccctggaccttggttttgttg | FAM | ccacctccaagcccagattcagattcgag | BHQ1 | 134 |
TBP | ggttgtaaacttgacctaaag | gttcgtggctctcttatc | FAM | tgattaccgcagcaaaccgc | BHQ1 | 134 |
RPLP | gacggattacaccttccc | gactcttccttggcttca | Cy5 | ccttcttggctgatccatctgc | BHQ2 | 139 |
Nucleic acid sequence of primers and probes.
Fluorophores used: Cy5; Cyanine fluorophore, FAM; Fluorescein amidite.
Quenchers are non-fluorescent chromophores quenching non-hydrolysed probes by fluorescence resonance energy transfer (FRET): BHQ1; black hole quencher 1 deoxythymidine, BHQ2; black hole quencher 2 deoxythymidine.