Table 2. Primers used for PCR and sequence and fragment analyses for hmbR and hpuA.
Target | PCR/Seq/fraga | Primer ID (direction) | Primer sequence (5′ to 3′) | Reference | Approx size (bases) |
hmbR | PCR/Seq/fragb | hmbR-RF3 (fwd) | TGCCAACCTCTTTTACGAATGG | [25] | 400 |
hmbR-RF4 (rev) | GCTACTGAACACGTCGTTCC | [35] | |||
PCRc | hmbRzF (fwd) | CCACA(A/G)CTT(C/T)TTGGGTAAGATTGC | This study | 1000 | |
hmbRzR (rev) | GACGCTACTTTGTCCACATTCAGACG | This study | |||
PCRd | hmbReF (fwd) | AAAT(C/T)AACGA(C/T)AACCACCGCATCG | This study | 600 | |
hmbRyR (rev) | GGCATTCAATTCCTGAGGCGTCA | This study | |||
PCRe | exl3-seqF (fwd) | GGCGGAGTGCAAAATGATGC | [15] | 600 | |
exl3-seqR (rev) | GCCATCTTTTAATTTAGCCGC | [15] | |||
hpuA | PCR/Seq/fragb | hpuAC (fwd) | ATGCGATGAAATACAAAGCCC | [25] | 350 |
hpuA350Rev (rev) | GGATGAAAGGGCGTATTGCGC | [25] | |||
PCRf | hpuAFnest2 (fwd) | CAAATCCGCCAACGAAGCGAT(C/T)AA | This study | 2000 | |
P26.85 (rev) | GGGAAACGCTTGGGCGATGG | [36] | |||
PCRg | Hpu-pmt (fwd) | CCGATTTTTGCACCGACCCAC | This study | 600 | |
hpuR-Seq3 (rev) | GAGGTCGATTTCGCCGTTGG | This study | |||
PCRh | hpuA-for1 (fwd) | GCAACAATGCCTTGTCATCC | [16] | 1000–3000 | |
hpuA-rev13 (rev) | TGATCGAAATGGGCGTACTC | [16] |
Purpose; conditions
Characterisation of homopolymeric tract and closely flanking regions; PCR - [MgCl2] = 2.5 mM, 25 (up to 45 for direct non-culture fragment analysis) cycles of (95°C – 30 seconds, 53°C – 30 seconds, 72°C – 60 seconds). Sequence analysis annealing temperature = 53°C. For fragment analysis, primers hmbR-RF3 and hpuA350Rev were FAM-labeled.
‘Round 1’ nested PCR for non-culture characterization of homopolymeric tract and closely flanking regions; [MgCl2] = 3 mM, 45 cycles of (95°C – 30 seconds, 56°C – 30 seconds, 72°C – 60 seconds).
d‘Round 2’ nested PCR for non-culture characterization of homopolymeric tract and closely flanking regions; [MgCl2] = 3 mM, 25 cycles of (95°C – 30 seconds, 56°C – 30 seconds, 72°C – 60 seconds).
eConfirmation of presence of exl3 (that replaces hmbR); [MgCl2] = 3 mM, 35 cycles of (95°C for 30 seconds, 56°C for 30 seconds, 72°C for 60 seconds).
f’Round 1’ nested PCR for non-culture characterization of homopolymeric tract and closely flanking regions; [MgCl2] = 3 mM, 45 cycles of (95°C – 30 seconds, 57°C – 30 seconds, 72°C – 150 seconds).
g‘Round 2’ nested PCR for non-culture characterization of homopolymeric tract and closely flanking regions; [MgCl2] = 3 mM, 25 cycles of (95°C – 30 seconds, 59°C – 30 seconds, 72°C – 60 seconds).
Confirmation of absence of hpuA; [MgCl2] = 3 mM, 35 cycles (95°C – 30 seconds, 53°C – 30 seconds, 72°C – 180 seconds).
Seq = sequence analysis
Frag = fragment analysis