Table 1.

Genomic and cDNA Primer Sequences Used to Amplify TYROBP, TREM1, TREM2, and ACTB

	Primera(5′→3′)
Fragment	Forward	Reverse
TYROBP:
Exon 1	tggggacggaggtgaagttt	cccatcccaacacccacttt
Exon 2	gcctgtgggtttctcccaga	ggcagggaggtttggaaagg
Exon 3	ccgtctctcccacacccttt	cctccattaccatccctttgga
Exon 4	gggctgggtaaactcccaga	cccagcccctcttcacacat
Exon 5	gcagaggagaagggggaaca	agtattggggagcggtctgg
Intron 1	gtggtgagttaggggcttcc	tctgcacaacttgtcctgtgg
TYROBP by quantitative RT-PCR	atggggggacttgaaccc	tcatttgtaatacggcctctgtg
TREM1:
Exon 1	acttaactgagaagtgagtcttggtctc	gcagtagtatatttgctgtcccatagtag
Exon 2	atatgggtggttggacaagaaa	agacagactgctgggaatcct
Exon 3	ctcatccacattttcatccatacatc	gacatttctacccagactaatgtgact
Exon 4	gcaaggatctaagcagaggaga	tgtttggggctgtaacttcttt
TREM2:
Exon 1	caccgccttcataattcacc	gactcctcctcccctctgtc
Exon 2	agtgggtggttctgcacac	tccttcagggcaggattttt
Exon 3	gctctagttgccttgtaatttgtagtt	agtgtaatgacctgatccacataggac
Exons 4 and 5	agcaaaatctcttgtctttttctcatc	cctagaactcaagtctcttgactatgg
Exon 4 seq	tcttccttcacgtgtctctcag	cccattccctgagagaagatt
Exon 5 seq	cctcaaggagcaaaatctcttgt	ccagggtatcagctccaaac
TREM2 probe	atggagcctctccggctgct	tcacgtgtctctcagccctg
TREM2 by quantitative RT-PCR	atggagcctctccggctgct	tcacgtgtctctcagccctg
ACTB:
ACTB by quantitative RT-PCR	tcacccacactgtgcccatctacga	cagcggaaccgctcattgccaatgg

^aExcept in the cases of exons 4 and 5 of TREM2 that were sequenced by primers with the designation ending with “seq,” PCR primers were used for sequencing.